ID: 1201825087

View in Genome Browser
Species Human (GRCh38)
Location Y:18234750-18234772
Sequence AGTGGGTACACTGACTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825087_1201825097 10 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data
1201825087_1201825101 23 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data
1201825087_1201825095 -6 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825095 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
1201825087_1201825093 -10 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825093 Y:18234763-18234785 TGTACCCACTGGGTAGTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825087 Original CRISPR AGTGGGTACACTGACTCTGG TGG (reversed) Intergenic