ID: 1201825089

View in Genome Browser
Species Human (GRCh38)
Location Y:18234753-18234775
Sequence CCCAGTGGGTACACTGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825089_1201825095 -9 Left 1201825089 Y:18234753-18234775 CCAGAGTCAGTGTACCCACTGGG No data
Right 1201825095 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
1201825089_1201825097 7 Left 1201825089 Y:18234753-18234775 CCAGAGTCAGTGTACCCACTGGG No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data
1201825089_1201825101 20 Left 1201825089 Y:18234753-18234775 CCAGAGTCAGTGTACCCACTGGG No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825089 Original CRISPR CCCAGTGGGTACACTGACTC TGG (reversed) Intergenic
No off target data available for this crispr