ID: 1201825094

View in Genome Browser
Species Human (GRCh38)
Location Y:18234767-18234789
Sequence CCAGCCCCGCACTACCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825094_1201825101 6 Left 1201825094 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data
1201825094_1201825097 -7 Left 1201825094 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825094 Original CRISPR CCAGCCCCGCACTACCCAGT GGG (reversed) Intergenic