ID: 1201825094 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:18234767-18234789 |
Sequence | CCAGCCCCGCACTACCCAGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201825094_1201825101 | 6 | Left | 1201825094 | Y:18234767-18234789 | CCCACTGGGTAGTGCGGGGCTGG | No data | ||
Right | 1201825101 | Y:18234796-18234818 | CAATATCTGGCACCCAACGCAGG | No data | ||||
1201825094_1201825097 | -7 | Left | 1201825094 | Y:18234767-18234789 | CCCACTGGGTAGTGCGGGGCTGG | No data | ||
Right | 1201825097 | Y:18234783-18234805 | GGGCTGGTTTCCCCAATATCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201825094 | Original CRISPR | CCAGCCCCGCACTACCCAGT GGG (reversed) | Intergenic | ||