ID: 1201825095

View in Genome Browser
Species Human (GRCh38)
Location Y:18234767-18234789
Sequence CCCACTGGGTAGTGCGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825089_1201825095 -9 Left 1201825089 Y:18234753-18234775 CCAGAGTCAGTGTACCCACTGGG No data
Right 1201825095 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
1201825087_1201825095 -6 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825095 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825095 Original CRISPR CCCACTGGGTAGTGCGGGGC TGG Intergenic