ID: 1201825096

View in Genome Browser
Species Human (GRCh38)
Location Y:18234768-18234790
Sequence ACCAGCCCCGCACTACCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825096_1201825101 5 Left 1201825096 Y:18234768-18234790 CCACTGGGTAGTGCGGGGCTGGT No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data
1201825096_1201825097 -8 Left 1201825096 Y:18234768-18234790 CCACTGGGTAGTGCGGGGCTGGT No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825096 Original CRISPR ACCAGCCCCGCACTACCCAG TGG (reversed) Intergenic