ID: 1201825097

View in Genome Browser
Species Human (GRCh38)
Location Y:18234783-18234805
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825094_1201825097 -7 Left 1201825094 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data
1201825096_1201825097 -8 Left 1201825096 Y:18234768-18234790 CCACTGGGTAGTGCGGGGCTGGT No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data
1201825087_1201825097 10 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data
1201825089_1201825097 7 Left 1201825089 Y:18234753-18234775 CCAGAGTCAGTGTACCCACTGGG No data
Right 1201825097 Y:18234783-18234805 GGGCTGGTTTCCCCAATATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825097 Original CRISPR GGGCTGGTTTCCCCAATATC TGG Intergenic