ID: 1201825101

View in Genome Browser
Species Human (GRCh38)
Location Y:18234796-18234818
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201825089_1201825101 20 Left 1201825089 Y:18234753-18234775 CCAGAGTCAGTGTACCCACTGGG No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data
1201825087_1201825101 23 Left 1201825087 Y:18234750-18234772 CCACCAGAGTCAGTGTACCCACT No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data
1201825094_1201825101 6 Left 1201825094 Y:18234767-18234789 CCCACTGGGTAGTGCGGGGCTGG No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data
1201825096_1201825101 5 Left 1201825096 Y:18234768-18234790 CCACTGGGTAGTGCGGGGCTGGT No data
Right 1201825101 Y:18234796-18234818 CAATATCTGGCACCCAACGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201825101 Original CRISPR CAATATCTGGCACCCAACGC AGG Intergenic
No off target data available for this crispr