ID: 1201830455

View in Genome Browser
Species Human (GRCh38)
Location Y:18288218-18288240
Sequence TCTTGGGTGAACAGGCAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201830455_1201830459 -4 Left 1201830455 Y:18288218-18288240 CCTGTTTGCCTGTTCACCCAAGA No data
Right 1201830459 Y:18288237-18288259 AAGACAATCCTAAGCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201830455 Original CRISPR TCTTGGGTGAACAGGCAAAC AGG (reversed) Intergenic
No off target data available for this crispr