ID: 1201830459

View in Genome Browser
Species Human (GRCh38)
Location Y:18288237-18288259
Sequence AAGACAATCCTAAGCAAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201830455_1201830459 -4 Left 1201830455 Y:18288218-18288240 CCTGTTTGCCTGTTCACCCAAGA No data
Right 1201830459 Y:18288237-18288259 AAGACAATCCTAAGCAAAAATGG No data
1201830454_1201830459 9 Left 1201830454 Y:18288205-18288227 CCAACTATTTGAGCCTGTTTGCC No data
Right 1201830459 Y:18288237-18288259 AAGACAATCCTAAGCAAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201830459 Original CRISPR AAGACAATCCTAAGCAAAAA TGG Intergenic
No off target data available for this crispr