ID: 1201830577

View in Genome Browser
Species Human (GRCh38)
Location Y:18289402-18289424
Sequence CCTGATAAGCTGGGATTACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201830577_1201830583 -10 Left 1201830577 Y:18289402-18289424 CCCTGTAATCCCAGCTTATCAGG No data
Right 1201830583 Y:18289415-18289437 GCTTATCAGGATGTTGAGGCAGG No data
1201830577_1201830584 8 Left 1201830577 Y:18289402-18289424 CCCTGTAATCCCAGCTTATCAGG No data
Right 1201830584 Y:18289433-18289455 GCAGGAGAATCACTTGAAGCTGG 0: 308
1: 37154
2: 85720
3: 104428
4: 125021
1201830577_1201830585 9 Left 1201830577 Y:18289402-18289424 CCCTGTAATCCCAGCTTATCAGG No data
Right 1201830585 Y:18289434-18289456 CAGGAGAATCACTTGAAGCTGGG 0: 165
1: 22061
2: 87419
3: 151117
4: 181551

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201830577 Original CRISPR CCTGATAAGCTGGGATTACA GGG (reversed) Intergenic
No off target data available for this crispr