ID: 1201830678

View in Genome Browser
Species Human (GRCh38)
Location Y:18290364-18290386
Sequence CCATGGCACATGTAAACCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201830673_1201830678 14 Left 1201830673 Y:18290327-18290349 CCTGAGGTCGGGAGTTTGAGATA No data
Right 1201830678 Y:18290364-18290386 CCATGGCACATGTAAACCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201830678 Original CRISPR CCATGGCACATGTAAACCTA TGG Intergenic
No off target data available for this crispr