ID: 1201830908

View in Genome Browser
Species Human (GRCh38)
Location Y:18291639-18291661
Sequence ACCAGGGCAGAGAGGGTCGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201830902_1201830908 1 Left 1201830902 Y:18291615-18291637 CCACGGGTGAAAACTACCAGAAA No data
Right 1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201830908 Original CRISPR ACCAGGGCAGAGAGGGTCGT AGG Intergenic
No off target data available for this crispr