ID: 1201835751

View in Genome Browser
Species Human (GRCh38)
Location Y:18333336-18333358
Sequence GGTTATCTGCAGATAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201835748_1201835751 3 Left 1201835748 Y:18333310-18333332 CCAGAGGCTAGCTGGATAGAAAG No data
Right 1201835751 Y:18333336-18333358 GGTTATCTGCAGATAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201835751 Original CRISPR GGTTATCTGCAGATAATGGC AGG Intergenic
No off target data available for this crispr