ID: 1201836703

View in Genome Browser
Species Human (GRCh38)
Location Y:18339112-18339134
Sequence GCAGCCCCTGTGTTGGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201836695_1201836703 11 Left 1201836695 Y:18339078-18339100 CCGGGGTCGTTCAACAGATGGCA No data
Right 1201836703 Y:18339112-18339134 GCAGCCCCTGTGTTGGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201836703 Original CRISPR GCAGCCCCTGTGTTGGGGCC GGG Intergenic