ID: 1201837788

View in Genome Browser
Species Human (GRCh38)
Location Y:18343747-18343769
Sequence GTGTGCATCTCGCCCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201837780_1201837788 27 Left 1201837780 Y:18343697-18343719 CCCTGCGCCGGTCCTGGCGGTGT No data
Right 1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG No data
1201837783_1201837788 15 Left 1201837783 Y:18343709-18343731 CCTGGCGGTGTCGTAGAGTCCCT No data
Right 1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG No data
1201837782_1201837788 20 Left 1201837782 Y:18343704-18343726 CCGGTCCTGGCGGTGTCGTAGAG No data
Right 1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG No data
1201837785_1201837788 -4 Left 1201837785 Y:18343728-18343750 CCCTGGCTTGTACTCAAGAGTGT No data
Right 1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG No data
1201837781_1201837788 26 Left 1201837781 Y:18343698-18343720 CCTGCGCCGGTCCTGGCGGTGTC No data
Right 1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG No data
1201837786_1201837788 -5 Left 1201837786 Y:18343729-18343751 CCTGGCTTGTACTCAAGAGTGTG No data
Right 1201837788 Y:18343747-18343769 GTGTGCATCTCGCCCTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201837788 Original CRISPR GTGTGCATCTCGCCCTCAGG AGG Intergenic
No off target data available for this crispr