ID: 1201838103

View in Genome Browser
Species Human (GRCh38)
Location Y:18345023-18345045
Sequence GCCTCGAGGTTGTTTTCCCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201838103_1201838115 27 Left 1201838103 Y:18345023-18345045 CCCGGGGAAAACAACCTCGAGGC No data
Right 1201838115 Y:18345073-18345095 TTCCTGGCGGCCCCTGCGCCGGG No data
1201838103_1201838108 -7 Left 1201838103 Y:18345023-18345045 CCCGGGGAAAACAACCTCGAGGC No data
Right 1201838108 Y:18345039-18345061 TCGAGGCTGGGATTCTCCCACGG No data
1201838103_1201838112 14 Left 1201838103 Y:18345023-18345045 CCCGGGGAAAACAACCTCGAGGC No data
Right 1201838112 Y:18345060-18345082 GGACGACAGTGCCTTCCTGGCGG No data
1201838103_1201838114 26 Left 1201838103 Y:18345023-18345045 CCCGGGGAAAACAACCTCGAGGC No data
Right 1201838114 Y:18345072-18345094 CTTCCTGGCGGCCCCTGCGCCGG No data
1201838103_1201838111 11 Left 1201838103 Y:18345023-18345045 CCCGGGGAAAACAACCTCGAGGC No data
Right 1201838111 Y:18345057-18345079 CACGGACGACAGTGCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201838103 Original CRISPR GCCTCGAGGTTGTTTTCCCC GGG (reversed) Intergenic