ID: 1201838197

View in Genome Browser
Species Human (GRCh38)
Location Y:18345381-18345403
Sequence TTGTGTGTCTCGCCCTCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201838197_1201838207 23 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838207 Y:18345427-18345449 AGGGCCCCCCAGCCCGCCGCAGG No data
1201838197_1201838202 -5 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838202 Y:18345399-18345421 CACAACCTTTGTGCAAGACAGGG No data
1201838197_1201838208 24 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838208 Y:18345428-18345450 GGGCCCCCCAGCCCGCCGCAGGG No data
1201838197_1201838205 4 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838205 Y:18345408-18345430 TGTGCAAGACAGGGACTCCAGGG No data
1201838197_1201838209 25 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838209 Y:18345429-18345451 GGCCCCCCAGCCCGCCGCAGGGG No data
1201838197_1201838204 3 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838204 Y:18345407-18345429 TTGTGCAAGACAGGGACTCCAGG No data
1201838197_1201838201 -6 Left 1201838197 Y:18345381-18345403 CCCCCTGAGGGCGAGACACACAA No data
Right 1201838201 Y:18345398-18345420 ACACAACCTTTGTGCAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201838197 Original CRISPR TTGTGTGTCTCGCCCTCAGG GGG (reversed) Intergenic
No off target data available for this crispr