ID: 1201840611

View in Genome Browser
Species Human (GRCh38)
Location Y:18368618-18368640
Sequence CAAGCTCCCAACATTGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201840611_1201840615 18 Left 1201840611 Y:18368618-18368640 CCCATCTCAATGTTGGGAGCTTG No data
Right 1201840615 Y:18368659-18368681 CACATGAGTCGAAGAGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201840611 Original CRISPR CAAGCTCCCAACATTGAGAT GGG (reversed) Intergenic
No off target data available for this crispr