ID: 1201840651

View in Genome Browser
Species Human (GRCh38)
Location Y:18368904-18368926
Sequence AGGAAGAGCACAATGACTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201840645_1201840651 22 Left 1201840645 Y:18368859-18368881 CCCAGCAGCAGCCACACAGCACA No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data
1201840647_1201840651 11 Left 1201840647 Y:18368870-18368892 CCACACAGCACAGAGAAACTTGT No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data
1201840642_1201840651 27 Left 1201840642 Y:18368854-18368876 CCCCACCCAGCAGCAGCCACACA No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data
1201840644_1201840651 25 Left 1201840644 Y:18368856-18368878 CCACCCAGCAGCAGCCACACAGC No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data
1201840643_1201840651 26 Left 1201840643 Y:18368855-18368877 CCCACCCAGCAGCAGCCACACAG No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data
1201840641_1201840651 28 Left 1201840641 Y:18368853-18368875 CCCCCACCCAGCAGCAGCCACAC No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data
1201840646_1201840651 21 Left 1201840646 Y:18368860-18368882 CCAGCAGCAGCCACACAGCACAG No data
Right 1201840651 Y:18368904-18368926 AGGAAGAGCACAATGACTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201840651 Original CRISPR AGGAAGAGCACAATGACTGA AGG Intergenic
No off target data available for this crispr