ID: 1201841846

View in Genome Browser
Species Human (GRCh38)
Location Y:18382591-18382613
Sequence TAAGGGGGCTGCCTCTGAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201841846_1201841854 -3 Left 1201841846 Y:18382591-18382613 CCCCTTCAGAGGCAGCCCCCTTA No data
Right 1201841854 Y:18382611-18382633 TTAACCCCTGGCCGTCACAGAGG No data
1201841846_1201841859 8 Left 1201841846 Y:18382591-18382613 CCCCTTCAGAGGCAGCCCCCTTA No data
Right 1201841859 Y:18382622-18382644 CCGTCACAGAGGAAGTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201841846 Original CRISPR TAAGGGGGCTGCCTCTGAAG GGG (reversed) Intergenic
No off target data available for this crispr