ID: 1201842583

View in Genome Browser
Species Human (GRCh38)
Location Y:18388074-18388096
Sequence ACCACTGATGACCATACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201842582_1201842583 -2 Left 1201842582 Y:18388053-18388075 CCATTTTGCATTGTGGTGGTGAC No data
Right 1201842583 Y:18388074-18388096 ACCACTGATGACCATACACCTGG No data
1201842579_1201842583 18 Left 1201842579 Y:18388033-18388055 CCTCACATGTGACACTTGGTCCA No data
Right 1201842583 Y:18388074-18388096 ACCACTGATGACCATACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201842583 Original CRISPR ACCACTGATGACCATACACC TGG Intergenic
No off target data available for this crispr