ID: 1201843677

View in Genome Browser
Species Human (GRCh38)
Location Y:18398767-18398789
Sequence AAACTCTGCTTCAGAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201843675_1201843677 21 Left 1201843675 Y:18398723-18398745 CCAGTCTACTTCATAATTTTGTT No data
Right 1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201843677 Original CRISPR AAACTCTGCTTCAGAAAGAC AGG Intergenic