ID: 1201843677 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:18398767-18398789 |
| Sequence | AAACTCTGCTTCAGAAAGAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201843675_1201843677 | 21 | Left | 1201843675 | Y:18398723-18398745 | CCAGTCTACTTCATAATTTTGTT | No data | ||
| Right | 1201843677 | Y:18398767-18398789 | AAACTCTGCTTCAGAAAGACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201843677 | Original CRISPR | AAACTCTGCTTCAGAAAGAC AGG | Intergenic | ||