ID: 1201844803

View in Genome Browser
Species Human (GRCh38)
Location Y:18411528-18411550
Sequence TGGGCAAGACCTCCCAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201844803_1201844808 -8 Left 1201844803 Y:18411528-18411550 CCCCTTTTGGGAGGTCTTGCCCA No data
Right 1201844808 Y:18411543-18411565 CTTGCCCAGTCAGGAGGAACAGG No data
1201844803_1201844812 -1 Left 1201844803 Y:18411528-18411550 CCCCTTTTGGGAGGTCTTGCCCA No data
Right 1201844812 Y:18411550-18411572 AGTCAGGAGGAACAGGATCAGGG 0: 30
1: 70
2: 143
3: 212
4: 612
1201844803_1201844813 21 Left 1201844803 Y:18411528-18411550 CCCCTTTTGGGAGGTCTTGCCCA No data
Right 1201844813 Y:18411572-18411594 GACTGCTTAAAGAAGCAGTCTGG No data
1201844803_1201844811 -2 Left 1201844803 Y:18411528-18411550 CCCCTTTTGGGAGGTCTTGCCCA No data
Right 1201844811 Y:18411549-18411571 CAGTCAGGAGGAACAGGATCAGG 0: 29
1: 75
2: 164
3: 242
4: 628

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201844803 Original CRISPR TGGGCAAGACCTCCCAAAAG GGG (reversed) Intergenic
No off target data available for this crispr