ID: 1201845891

View in Genome Browser
Species Human (GRCh38)
Location Y:18422656-18422678
Sequence CACTCCACGGTGAACTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201845891_1201845901 20 Left 1201845891 Y:18422656-18422678 CCTCACCAGTTCACCGTGGAGTG No data
Right 1201845901 Y:18422699-18422721 ACTGGGAACCAAATGAGGCAAGG No data
1201845891_1201845894 2 Left 1201845891 Y:18422656-18422678 CCTCACCAGTTCACCGTGGAGTG No data
Right 1201845894 Y:18422681-18422703 ACCCAAATGAGAACCCTAACTGG No data
1201845891_1201845896 3 Left 1201845891 Y:18422656-18422678 CCTCACCAGTTCACCGTGGAGTG No data
Right 1201845896 Y:18422682-18422704 CCCAAATGAGAACCCTAACTGGG No data
1201845891_1201845902 27 Left 1201845891 Y:18422656-18422678 CCTCACCAGTTCACCGTGGAGTG No data
Right 1201845902 Y:18422706-18422728 ACCAAATGAGGCAAGGAACATGG No data
1201845891_1201845899 15 Left 1201845891 Y:18422656-18422678 CCTCACCAGTTCACCGTGGAGTG No data
Right 1201845899 Y:18422694-18422716 CCCTAACTGGGAACCAAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201845891 Original CRISPR CACTCCACGGTGAACTGGTG AGG (reversed) Intergenic
No off target data available for this crispr