ID: 1201846510

View in Genome Browser
Species Human (GRCh38)
Location Y:18427963-18427985
Sequence CACAGCTAAAATGCACAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201846508_1201846510 -5 Left 1201846508 Y:18427945-18427967 CCAAGCTGTCATAAAATCCACAG No data
Right 1201846510 Y:18427963-18427985 CACAGCTAAAATGCACAAGTTGG No data
1201846507_1201846510 16 Left 1201846507 Y:18427924-18427946 CCTAGAAATTGATAATAATGGCC No data
Right 1201846510 Y:18427963-18427985 CACAGCTAAAATGCACAAGTTGG No data
1201846505_1201846510 26 Left 1201846505 Y:18427914-18427936 CCAACTGTTGCCTAGAAATTGAT No data
Right 1201846510 Y:18427963-18427985 CACAGCTAAAATGCACAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201846510 Original CRISPR CACAGCTAAAATGCACAAGT TGG Intergenic
No off target data available for this crispr