ID: 1201848603

View in Genome Browser
Species Human (GRCh38)
Location Y:18451427-18451449
Sequence CATTTTAGGCACAGGGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201848594_1201848603 26 Left 1201848594 Y:18451378-18451400 CCAAACGCAATCTCCTGGTCTGC No data
Right 1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG No data
1201848599_1201848603 -9 Left 1201848599 Y:18451413-18451435 CCATGGGAGAAGCACATTTTAGG No data
Right 1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG No data
1201848596_1201848603 13 Left 1201848596 Y:18451391-18451413 CCTGGTCTGCAGGTTTTCAAGAC No data
Right 1201848603 Y:18451427-18451449 CATTTTAGGCACAGGGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201848603 Original CRISPR CATTTTAGGCACAGGGTGCA TGG Intergenic
No off target data available for this crispr