ID: 1201856042

View in Genome Browser
Species Human (GRCh38)
Location Y:18544148-18544170
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 2, 1: 0, 2: 1, 3: 10, 4: 162}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201856037_1201856042 10 Left 1201856037 Y:18544115-18544137 CCTGCCAGTGACTGGTATTTGGC 0: 2
1: 0
2: 5
3: 12
4: 125
Right 1201856042 Y:18544148-18544170 ATTCACAGGGAACTTATAATTGG 0: 2
1: 0
2: 1
3: 10
4: 162
1201856038_1201856042 6 Left 1201856038 Y:18544119-18544141 CCAGTGACTGGTATTTGGCTTTG 0: 2
1: 0
2: 4
3: 29
4: 154
Right 1201856042 Y:18544148-18544170 ATTCACAGGGAACTTATAATTGG 0: 2
1: 0
2: 1
3: 10
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201856042 Original CRISPR ATTCACAGGGAACTTATAAT TGG Intergenic
907014980 1:51003924-51003946 ATACCCAGGGAACTTAAAAGAGG + Intergenic
908028594 1:59976055-59976077 ATTCACAGGGAGCTTCTAAAGGG - Intergenic
908459203 1:64332920-64332942 AATCAGAGGGGTCTTATAATTGG - Intergenic
911651569 1:100394778-100394800 ATACACACGGAACTAAAAATTGG + Intronic
912117986 1:106431499-106431521 ACTCTCATGGAACTTGTAATGGG + Intergenic
912256289 1:108061839-108061861 ACTCACAGGGTACTTAAAAGAGG + Intergenic
917781606 1:178403440-178403462 ATTCATAGGGAATATAAAATAGG + Intronic
918575242 1:186050852-186050874 GTTCTCACGGAACTTATAGTTGG + Intronic
918892737 1:190295982-190296004 AATCACTGGGAACTTCTAATTGG + Intronic
919188012 1:194179915-194179937 AGTCAGAGGGCACTGATAATGGG - Intergenic
1064374499 10:14783414-14783436 AATCAAAGTGAACTTAAAATGGG + Intergenic
1064608722 10:17074171-17074193 GCTCACAAGGAACTTACAATAGG + Intronic
1064715134 10:18168816-18168838 ATTCACAAGGAGCTTGTATTTGG - Intronic
1069696008 10:70385956-70385978 ATTCTCAGGGCACTTGTAAAAGG + Intergenic
1073807596 10:107115958-107115980 ATTCAAAGGAAACATATAAATGG + Intronic
1073921839 10:108467615-108467637 ATTTACAAGGAAGTTATAAAAGG + Intergenic
1076493923 10:130884546-130884568 ATTCACAGTTAACTTATCCTGGG + Intergenic
1078028567 11:7724138-7724160 ATTCAGAGGGGACTGATCATAGG + Intergenic
1079782571 11:24626433-24626455 ATTCACTGTGAAATTATACTTGG - Intronic
1081353466 11:42084266-42084288 AATCAAAGGGAACTTAGAAAGGG + Intergenic
1082143113 11:48632850-48632872 ATTCTGAGGGAAGTTATAAGTGG - Intergenic
1082570310 11:54730213-54730235 ATTCTGAGGGAAGTTATAAGTGG - Intergenic
1086283214 11:85214975-85214997 ATGCACAGGGAATTGATATTTGG - Intronic
1086389304 11:86345535-86345557 ATTCACAAGAAAATTAAAATAGG - Intronic
1088281592 11:108140394-108140416 ATACTCAGGGATCTTATAAATGG - Intronic
1091382350 12:70059-70081 ATTCACAGGAAACCCATGATTGG - Intronic
1091752994 12:3034093-3034115 GCTCTCAGGGAATTTATAATCGG - Intronic
1091916835 12:4275774-4275796 ATTCCCAGGGATCCTATAAAAGG - Intronic
1092340073 12:7668083-7668105 AATCACAGGGTCCTTATAAGAGG + Intergenic
1095301073 12:40584615-40584637 TTTCATAGGAAACTTATACTGGG + Intergenic
1095738080 12:45579712-45579734 ATTCACAGGGTACAAGTAATAGG + Intergenic
1095747667 12:45677547-45677569 TTTCACAGGAAAGTTATATTAGG + Intergenic
1097015695 12:55985472-55985494 ATTCAAAGGGAAGTTAGCATAGG - Intronic
1098661612 12:73101406-73101428 CTGCACAGGCAACTTAGAATAGG - Intergenic
1098942601 12:76554678-76554700 ATTCAGAGGGAAATTGTTATAGG - Intronic
1098989503 12:77049175-77049197 ATTCACATGGCATTTCTAATGGG - Intronic
1099380222 12:81943983-81944005 ATTCACATGGAAATGAAAATTGG + Intergenic
1099851568 12:88104266-88104288 ATTCAAAGTGAAATTAAAATGGG - Intronic
1100553259 12:95667371-95667393 TTTCACAGGGAAGTTCTTATCGG + Intronic
1102757906 12:115358278-115358300 TTTCACAGGGAACAAAGAATTGG - Intergenic
1104324923 12:127786651-127786673 CTTCAAAGGGAACCTATAAAGGG - Intergenic
1108896416 13:55334532-55334554 CTTCACAGGGAACCTCTACTAGG + Intergenic
1109242407 13:59905705-59905727 AATCACAGGGTCCTTATAAGAGG + Intronic
1111011347 13:82318982-82319004 ATCCACAGTGGACCTATAATGGG - Intergenic
1111144261 13:84159408-84159430 TTTCAAAGGTAACATATAATTGG - Intergenic
1115140805 14:30168813-30168835 CTTCACAGAGAACCTATACTAGG - Intronic
1115141872 14:30181238-30181260 ATTCAAAGGGAATTTTAAATTGG - Intronic
1117515952 14:56501476-56501498 TTTCACAGGGATCTGATCATTGG - Intronic
1120945428 14:89990663-89990685 ATTCAAAGTGTACTTTTAATGGG + Intronic
1121185823 14:91967864-91967886 ACTCACAGAGAAATAATAATAGG + Exonic
1124117974 15:26865983-26866005 ATTAACAGGTAACTTAGATTTGG + Intronic
1125280870 15:38041607-38041629 ATGGAAAGGGAACTTATAAATGG - Intergenic
1126647216 15:50886399-50886421 ATTCACTGTACACTTATAATGGG - Intergenic
1126946489 15:53827450-53827472 CTTCTGAGGGCACTTATAATGGG + Intergenic
1128029407 15:64466420-64466442 ATTCACAGGGTACTAATTAACGG + Intronic
1138745836 16:59362613-59362635 TCTTACAAGGAACTTATAATTGG - Intergenic
1140893934 16:79308636-79308658 ATTCCCAGGCAACTGTTAATAGG - Intergenic
1142538059 17:633979-634001 AGCCACAGGGAACTTATAGTAGG + Intronic
1144670973 17:17132415-17132437 ATTTACTGAGAACCTATAATAGG - Intronic
1146071870 17:29689615-29689637 ATTCACCTGTAACTTGTAATAGG - Intronic
1148255284 17:46125655-46125677 ATTCAAAGGAAACATAAAATGGG + Intronic
1153141150 18:1973733-1973755 AATCACAGGGTCCTTATAAGAGG + Intergenic
1159485912 18:69057076-69057098 AGTCACAGGGAAATTATTACTGG - Intergenic
1159889121 18:73938246-73938268 AGTCACAGTGACCTCATAATTGG + Intergenic
1165248440 19:34511794-34511816 ATTCACAGGCAACTCACAAAAGG - Exonic
926930847 2:18039398-18039420 AATCACATGGAAGTTATTATGGG - Intronic
929044024 2:37773368-37773390 ATTCTGAGGGAGCTTAGAATAGG + Intergenic
930122644 2:47772375-47772397 ATCCACTGGGAAGTTCTAATGGG + Intronic
931205110 2:60139441-60139463 AGTGACAGGGACCTTATCATGGG - Intergenic
931277859 2:60759661-60759683 TTTCACAAGGACCTTCTAATGGG + Intronic
933034298 2:77373208-77373230 ATTGATAGGCAACTTGTAATAGG + Intronic
933921224 2:87048805-87048827 ATTCACAGGTGACTAATAACTGG + Intergenic
933930410 2:87144992-87145014 ATTCACAGGTGACTAATAACTGG - Intergenic
934001742 2:87720780-87720802 ATTCACAGGTGACTAATAACTGG - Intergenic
935427783 2:102938841-102938863 TTTCACAGGATACTTTTAATAGG - Intergenic
936128084 2:109809057-109809079 TTTTACAGGGAAGTTCTAATTGG + Intronic
936216613 2:110562428-110562450 TTTTACAGGGAAGTTCTAATTGG - Intronic
936362720 2:111820456-111820478 ATTCACAGGTGACTAATAACTGG + Intronic
936425752 2:112417009-112417031 TTTTACAGGGAAGTTCTAATTGG - Intronic
937714698 2:125018263-125018285 ATTCAGAGGAAACTCATAAAAGG - Intergenic
940293669 2:152100665-152100687 ATTCTCTGGGCACTTAGAATAGG + Intergenic
942047894 2:172110460-172110482 ATTCACAGGGAACTGACCCTAGG + Intergenic
943589229 2:189777932-189777954 ATTCAAAGGAAACTTAAATTTGG + Intronic
944089343 2:195888313-195888335 ATTCAAAAGGAATTCATAATGGG - Exonic
944611792 2:201417029-201417051 CTCCACAGATAACTTATAATGGG - Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
947021021 2:225675690-225675712 TTTCTCAAAGAACTTATAATAGG - Intergenic
1169885874 20:10397230-10397252 AATAACAAGGAACTAATAATTGG + Intergenic
1170066749 20:12318848-12318870 CTTCACAGAGAATTGATAATCGG + Intergenic
1170949157 20:20920188-20920210 ATTTCCAGAGAGCTTATAATGGG - Intergenic
1171843034 20:30238904-30238926 ATACACAAAGAACTTATTATAGG + Intergenic
1176282850 20:64324774-64324796 ATTCACAGGAAACCCATGATCGG + Intergenic
949485880 3:4537482-4537504 ATTCACAGGTAACATATACTAGG - Intronic
949657404 3:6236718-6236740 ATTCACAGGGAGACTTTAATGGG - Intergenic
950374895 3:12563263-12563285 TTTCCCAGGGAAATTATAAAAGG - Intronic
951770665 3:26253020-26253042 CTTCTCAGTGAAATTATAATAGG - Intergenic
953045704 3:39292342-39292364 AGTCACAAGGAACTTAGAAATGG - Intergenic
955645848 3:61136505-61136527 AGTCACAGAGTACTTACAATGGG + Intronic
959274319 3:104258368-104258390 ATTATCTGGGCACTTATAATAGG - Intergenic
960296905 3:115955543-115955565 CTTCTTAGGGAACTTATAACTGG + Intronic
962300745 3:134240475-134240497 ATTCACAGGGGACTTTTTAAAGG + Intronic
963885687 3:150579796-150579818 ATCCTCAGGGAACATAGAATAGG - Intronic
965945375 3:174234025-174234047 ATTCACATGGAACTTAAAATAGG - Intronic
970041494 4:11802127-11802149 AGTCACAGGAAACCTGTAATGGG - Intergenic
970072578 4:12178036-12178058 ATCCACACTGGACTTATAATGGG - Intergenic
970757989 4:19449956-19449978 GGTCTCAGGAAACTTATAATAGG + Intergenic
971503632 4:27342890-27342912 TTTCACAGTGAAATTTTAATGGG + Intergenic
978194528 4:105955424-105955446 ACTCAAAGAGAACTTAGAATAGG - Intronic
980978829 4:139636417-139636439 ATTCAAAGGGGATTTATCATGGG - Intergenic
981728362 4:147871709-147871731 ATGTACTTGGAACTTATAATTGG + Intronic
983300250 4:165915990-165916012 TTTCACTGGTAAGTTATAATTGG - Intronic
986649899 5:9953030-9953052 AATCACAGGGTCCTTATAAGCGG - Intergenic
986846643 5:11764069-11764091 AATCACAGGGTCCTTATAAATGG + Intronic
988177468 5:27744775-27744797 ACTGAGAGTGAACTTATAATGGG + Intergenic
988272512 5:29034675-29034697 ATTCTCAGAGTACTTAAAATGGG + Intergenic
989564135 5:42884622-42884644 TTTCACAGTGAAGTTCTAATTGG - Intronic
989709712 5:44383089-44383111 ATTCACAGGCAGCTCATAAATGG + Intronic
989823278 5:45821743-45821765 AGACAAAGGGAACTTTTAATAGG - Intergenic
990171687 5:53058296-53058318 TTTCACAGGGATCTTATATGGGG + Intronic
990919767 5:60949723-60949745 ATTCACAGAGACCTTTTACTTGG + Intronic
992688793 5:79223258-79223280 AATCACAGGGTCCTTAGAATTGG + Intronic
994712027 5:103277350-103277372 ATTCACCTGGAACTTTAAATGGG + Exonic
995273560 5:110251278-110251300 ATTCACACTGAACTTCTAATAGG - Intergenic
997587764 5:135053786-135053808 AATCACAGAGAACTTATTTTTGG - Intronic
998726207 5:145017580-145017602 TTTCAAAGAAAACTTATAATAGG - Intergenic
1002964278 6:1947187-1947209 GTTCACAGAGAACATTTAATTGG - Intronic
1004201298 6:13550395-13550417 ATTCACAGGGGAAATACAATAGG - Intergenic
1006979414 6:38134972-38134994 ATTCACAGGGATCTGGTTATTGG - Intronic
1008836956 6:55845361-55845383 ATTCACCTGGAACCTACAATGGG + Intronic
1010895226 6:81354229-81354251 TTTGACAGGGAACTTATACTAGG - Intergenic
1012264179 6:97120779-97120801 ATTCACTAGGAACTTTTAAGTGG - Intronic
1013992002 6:116264878-116264900 ATTCTGGGGGAACTTATATTAGG + Intronic
1015334713 6:132023823-132023845 ATTCCCTGGAAACTTATATTAGG + Intergenic
1016908630 6:149175762-149175784 AATCACAGGGTCCTTATAAGAGG - Intergenic
1017703811 6:157101395-157101417 ATTCACACGGACCTAAGAATAGG + Intronic
1020186703 7:5964523-5964545 ATGGACAGGGGACTTATATTTGG - Exonic
1020296213 7:6760251-6760273 ATGGACAGGGGACTTATATTTGG + Exonic
1020524987 7:9247985-9248007 TTTCACAGGGTACTTTTAAAAGG + Intergenic
1027591452 7:80124291-80124313 ATTCCCAGTGAATTTGTAATTGG - Intergenic
1027879147 7:83810860-83810882 ACACACAGAGAACATATAATAGG - Intergenic
1028968655 7:96831431-96831453 ATTCACATGGAACTGAAATTGGG - Intergenic
1033435480 7:141329784-141329806 ATTATCAGGGAACTGATAAAGGG + Intronic
1033918906 7:146363113-146363135 ATTTACATAGCACTTATAATAGG + Intronic
1034308032 7:150061989-150062011 CTTCTTAGGGAACATATAATGGG - Intergenic
1034798821 7:154038682-154038704 CTTCTTAGGGAACATATAATGGG + Intronic
1041480574 8:58315590-58315612 TTTCTCAGGGAAGTTTTAATAGG - Intergenic
1042301778 8:67290714-67290736 TTTCACTGTGAGCTTATAATGGG - Intronic
1045059115 8:98396917-98396939 ATTCACAAAGAACTTAGAATAGG - Intergenic
1045502968 8:102757367-102757389 ATTTACTGGTCACTTATAATCGG + Intergenic
1046876996 8:119266191-119266213 ATTAACAAGGAATTTCTAATGGG + Intergenic
1048948514 8:139473332-139473354 ATTTGCAGTGATCTTATAATAGG - Intergenic
1057760378 9:97869027-97869049 ACTCACAGGGAGCTTAGCATTGG - Intergenic
1059047651 9:110887003-110887025 ATTAACAGGAAGTTTATAATTGG + Intronic
1059825309 9:118021785-118021807 ATTCACAGGGAACTAGGGATTGG - Intergenic
1060025307 9:120165812-120165834 AATAACAGGGAATTTATTATGGG + Intergenic
1185650551 X:1644926-1644948 ATGCACAGGCAACTAATTATAGG + Intergenic
1186815371 X:13232117-13232139 GTTCACAAGCAACTTATGATAGG - Intergenic
1187584534 X:20645529-20645551 ATTCATATGGAACTAATAAAGGG + Intergenic
1187670982 X:21665638-21665660 ATCCACAGGGAACTGACAAATGG - Intergenic
1187808792 X:23152694-23152716 ACTGACAGGGAACTAATATTTGG + Intergenic
1188355256 X:29182860-29182882 ATTCACAGGGTCTTTATAAGAGG + Intronic
1189527097 X:41834492-41834514 ATTAACAGGCAACTTCAAATTGG - Intronic
1189830611 X:44969183-44969205 AATTTCAGGGAACTTATAATTGG - Intronic
1190873505 X:54444249-54444271 ATTCACAGGGAAGTGATAAGGGG + Intronic
1191142302 X:57128670-57128692 ATGCAAAGGGGATTTATAATAGG + Intergenic
1192730185 X:73795258-73795280 AATCACAGGGTCCTTATAAATGG + Intergenic
1194131843 X:90091073-90091095 ATTAACTGGGAACTATTAATAGG + Intergenic
1197091534 X:122544307-122544329 AGTCACAGGGAATTTATCAATGG + Intergenic
1197127905 X:122969745-122969767 ATTGAGAGTGCACTTATAATTGG - Intergenic
1197460558 X:126735886-126735908 CCTCACAGGGAACTTCTACTAGG - Intergenic
1197596856 X:128474541-128474563 ATTCACAGAGAAAATAAAATAGG + Intergenic
1199711024 X:150469737-150469759 ATTCACAGGGAACTGTTAAGAGG + Exonic
1200098882 X:153678652-153678674 AGACAGAGGGAACTTAAAATAGG - Intronic
1201856042 Y:18544148-18544170 ATTCACAGGGAACTTATAATTGG + Intergenic
1201877279 Y:18776237-18776259 ATTCACAGGGAACTTATAATTGG - Intronic