ID: 1201858262

View in Genome Browser
Species Human (GRCh38)
Location Y:18568932-18568954
Sequence TGACCCATAAACTTTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 2, 1: 0, 2: 6, 3: 14, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201858255_1201858262 25 Left 1201858255 Y:18568884-18568906 CCTGTGGGAGGGTGAGGCCTTGG 0: 2
1: 0
2: 3
3: 41
4: 330
Right 1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG 0: 2
1: 0
2: 6
3: 14
4: 186
1201858254_1201858262 26 Left 1201858254 Y:18568883-18568905 CCCTGTGGGAGGGTGAGGCCTTG 0: 2
1: 0
2: 1
3: 30
4: 301
Right 1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG 0: 2
1: 0
2: 6
3: 14
4: 186
1201858260_1201858262 8 Left 1201858260 Y:18568901-18568923 CCTTGGTTTGGTGTGGCAGGTTT 0: 2
1: 4
2: 0
3: 10
4: 134
Right 1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG 0: 2
1: 0
2: 6
3: 14
4: 186
1201858253_1201858262 27 Left 1201858253 Y:18568882-18568904 CCCCTGTGGGAGGGTGAGGCCTT 0: 2
1: 0
2: 0
3: 40
4: 279
Right 1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG 0: 2
1: 0
2: 6
3: 14
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201858262 Original CRISPR TGACCCATAAACTTTAAAAG AGG Intronic
903713097 1:25340734-25340756 TAAACCATAAACTCTTAAAGTGG - Intronic
904791899 1:33028838-33028860 TCAATCATAAACTTTAAAGGTGG - Intronic
904975239 1:34451170-34451192 TGACTCAGAAACTCTAGAAGTGG + Intergenic
909288136 1:73847323-73847345 TGAACCATACACTGAAAAAGGGG - Intergenic
910148071 1:84106198-84106220 TCACCCATATACTTTTAAACAGG - Intronic
923259574 1:232255586-232255608 TGACCACTAAACATGAAAAGGGG + Intergenic
923584483 1:235255355-235255377 TGAACTATAAACTTAAAAATAGG + Intronic
923892462 1:238230995-238231017 TGACCCAAAAATTATACAAGTGG - Intergenic
1064246093 10:13668736-13668758 TGGCCCTTAAGCTTTAAAAAGGG - Intronic
1064677038 10:17770681-17770703 TGACACAGAAAATTTAAATGTGG - Intronic
1065568378 10:27041102-27041124 TGACCTAGAAACTCTGAAAGCGG - Intronic
1068028199 10:51675192-51675214 TGACCCAGAAATCATAAAAGTGG + Intronic
1068072627 10:52214906-52214928 TGACCCACAAATTATAAAACCGG - Intronic
1071879184 10:89876360-89876382 TGGCCAATAAACATTAAAAGAGG + Intergenic
1076081713 10:127588246-127588268 TGACGCATTCACTTTAAAAATGG + Intergenic
1077762909 11:5122999-5123021 TGATCCATAAATTTTATAAGTGG + Intergenic
1078311505 11:10247946-10247968 TTACCAATAATCTTTAAAACTGG - Intronic
1080922406 11:36722220-36722242 TGAACCATAAAGGATAAAAGGGG - Intergenic
1083840215 11:65299985-65300007 TGAATCATACACTTTAAAATGGG - Intronic
1086776773 11:90845508-90845530 TGACTAATAAACTTTATCAGAGG + Intergenic
1087487979 11:98782633-98782655 TTGCACATAAACTTTAAAGGGGG - Intergenic
1090688070 11:129147837-129147859 TGAAGGATAAAGTTTAAAAGAGG - Intronic
1093539866 12:20268699-20268721 TAACCTATAAACTTAAAAATTGG + Intergenic
1093909476 12:24729572-24729594 AGAATCATAAACTTTAAAACTGG + Intergenic
1095131378 12:38547497-38547519 TTATCCATGAACTTTTAAAGAGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1098343551 12:69476047-69476069 AGAACCATAATCTTTAAAAAGGG - Intronic
1103406337 12:120678216-120678238 TATCCCATAAACTTAAAAATAGG + Intergenic
1103838584 12:123844466-123844488 TGGCCAATAAACATGAAAAGAGG + Intronic
1104688868 12:130809304-130809326 TAACCAACAAACTTTAAAACTGG + Intronic
1105634029 13:22200040-22200062 TAAAGGATAAACTTTAAAAGAGG + Intergenic
1105733646 13:23245664-23245686 TCACCCAGAAAATTTAAAGGCGG - Intronic
1106452775 13:29898217-29898239 TGACCAATAAACTCTCACAGAGG - Intergenic
1107204397 13:37764442-37764464 TGACTCATAAACTTTCATATTGG + Intronic
1108074872 13:46669398-46669420 TAGCCCATAAACTTCAAAAACGG - Intronic
1108893407 13:55292841-55292863 TAACACAAAAACTTTGAAAGAGG - Intergenic
1109346777 13:61124715-61124737 TAAACTATAAACTTTAAAAATGG + Intergenic
1109357821 13:61254364-61254386 TGTCCAATAAAATTAAAAAGTGG - Intergenic
1109588970 13:64450673-64450695 AAACCCATTAACTTTATAAGAGG + Intergenic
1111870673 13:93827827-93827849 TGAACCATTCACTTTCAAAGTGG + Intronic
1112960096 13:105113394-105113416 TGACCCATAAAAAGAAAAAGTGG + Intergenic
1113006606 13:105710894-105710916 TCTCCCAGAAAATTTAAAAGGGG - Intergenic
1115097030 14:29649677-29649699 TGGCCCTTCAACATTAAAAGAGG + Intronic
1116325380 14:43527284-43527306 TAACACATAAACTTAGAAAGTGG - Intergenic
1120034384 14:79680151-79680173 TAATCCATAAACTTTAACAGGGG + Intronic
1123424014 15:20154141-20154163 TGACACTTAAATTTAAAAAGAGG - Intergenic
1123533235 15:21160670-21160692 TGACACTTAAATTTAAAAAGAGG - Intergenic
1124414236 15:29461783-29461805 TGAACCATACACTTAAAAACTGG - Intronic
1127201981 15:56664181-56664203 TAACAGATAATCTTTAAAAGAGG + Intronic
1129783218 15:78288453-78288475 TGGCTCATAATCATTAAAAGGGG - Intronic
1131612284 15:93977744-93977766 TGACCCACATACTGTGAAAGAGG - Intergenic
1135560337 16:23471391-23471413 TGACCAATAAATTTAAAAAGGGG + Intronic
1136128477 16:28202952-28202974 TTACACATAATCTTGAAAAGTGG + Intronic
1136860857 16:33701745-33701767 TGACACTTAAATTTAAAAAGAGG + Intergenic
1136863504 16:33719140-33719162 TGACCCATATACCATATAAGTGG + Intergenic
1137452957 16:48594279-48594301 TAACCCACAAATTTTAAAACAGG - Intronic
1138572307 16:57883839-57883861 TCACCCATGAACTTTAAAAGTGG + Exonic
1139927771 16:70500711-70500733 TATCCCATAAAATTTAAAACAGG + Intronic
1141213895 16:82006490-82006512 TGACATATAAAATTCAAAAGGGG + Intronic
1203122352 16_KI270728v1_random:1549929-1549951 TGACACTTAAAATTAAAAAGAGG + Intergenic
1143287820 17:5803979-5804001 TGACTCATACACTTTTAAATGGG - Intronic
1143690176 17:8555762-8555784 TGAACCATAAAATTAAAAACTGG + Intronic
1144290841 17:13824747-13824769 GGATCCATAAACTTTATAATAGG + Intergenic
1150339061 17:64351260-64351282 TGAATCATAAACTTTAAAAAAGG - Intronic
1153667370 18:7378345-7378367 TCACCTATAAGCTGTAAAAGTGG + Intergenic
1156027851 18:32676614-32676636 TGAGCCAAAGATTTTAAAAGTGG + Intronic
1156785032 18:40901264-40901286 TGAACCACATACATTAAAAGGGG + Intergenic
1159848263 18:73493102-73493124 TCAAGCATAAACTTTCAAAGAGG + Intergenic
1159903554 18:74070010-74070032 TGACCCCGACACTTTTAAAGGGG + Intergenic
1160020893 18:75180285-75180307 TGAGACTTAACCTTTAAAAGAGG - Intergenic
1160667242 19:336736-336758 TGAATTATAAACTTTAAAATGGG + Intronic
1163483240 19:17571115-17571137 TGACCAATTAAAATTAAAAGAGG + Intronic
1163879624 19:19906044-19906066 TGACCCAGAAACCTTATAATTGG - Intronic
1165079291 19:33298476-33298498 GGAGCCATCAGCTTTAAAAGAGG + Intergenic
1165713869 19:38031441-38031463 TGACCCAGACACTTTGGAAGAGG + Intronic
1166585093 19:43938681-43938703 TGAACTTTATACTTTAAAAGGGG - Intergenic
1167391614 19:49198940-49198962 TGACCCATAAACTTTACATCTGG - Intronic
1167872871 19:52388173-52388195 TGGCCCATAAATTTTAAGAATGG + Intergenic
925579563 2:5396903-5396925 TGACACATAAACTTCAATTGTGG + Intergenic
926869779 2:17401840-17401862 TGACCAATAAACAATAAAAATGG - Intergenic
927449238 2:23192618-23192640 AGATCCATAAAAGTTAAAAGAGG - Intergenic
928117943 2:28561123-28561145 AGACCGATAAACACTAAAAGAGG - Intronic
931932521 2:67155849-67155871 AGACCCCTAAACAGTAAAAGGGG + Intergenic
932898247 2:75666152-75666174 TTAACCATAAACTATAAAATGGG - Intronic
933270068 2:80223821-80223843 TGACTGATAATCTTAAAAAGAGG + Intronic
933451335 2:82456352-82456374 TGATCCATAAACTCAAAATGTGG + Intergenic
934459233 2:94202901-94202923 TGACACTTAAATTTAAAAAGAGG + Intergenic
935145659 2:100393427-100393449 TGCCCCATACATCTTAAAAGAGG - Exonic
936712236 2:115144495-115144517 TGACCCATGAACTACAAACGTGG - Intronic
936897248 2:117442672-117442694 AGATCCATACAATTTAAAAGTGG + Intergenic
937161146 2:119762476-119762498 TGACTTACAAACTCTAAAAGCGG + Intronic
939928604 2:148203972-148203994 TGACCCTTATACTCTAAAATAGG - Intronic
940231229 2:151454813-151454835 TGAGCTATAAATTGTAAAAGTGG + Intronic
941825820 2:169895094-169895116 TAACCCATAAACCATAAAATGGG - Intronic
944562394 2:200953782-200953804 GAACCCATACACTTTAAAAATGG + Intronic
945466683 2:210177573-210177595 TGACCCACAAAATAAAAAAGTGG + Intergenic
945566097 2:211401896-211401918 TGGCCCAGAAAATATAAAAGAGG - Intronic
945699169 2:213149928-213149950 AGATCCGTAAAGTTTAAAAGAGG + Intronic
946754936 2:222934752-222934774 TGAACCCTAAACCTTAAAACAGG - Intronic
948503698 2:238413114-238413136 TGACCTATACACTTAAAAAATGG - Intergenic
1173030771 20:39357505-39357527 TGAATCAGAAACTTTGAAAGTGG - Intergenic
1173340642 20:42149719-42149741 TGACCCAGAAACTTTTTAAGAGG + Intronic
1174779613 20:53376888-53376910 TGACCCATAGAATGCAAAAGAGG - Intronic
1176367770 21:6044154-6044176 TGACCCTTAAACTTTGTAAAGGG - Intergenic
1176908016 21:14527791-14527813 TGATCCATAACCTCTAAAAGTGG + Intronic
1177357241 21:20024642-20024664 AGATCCATACAATTTAAAAGAGG + Intergenic
1177876435 21:26637664-26637686 TGACCAATAAACATACAAAGAGG - Intergenic
1178567743 21:33703757-33703779 TCACCTATAACCTTTAAAGGGGG + Intronic
1179755749 21:43494388-43494410 TGACCCTTAAACTTTGTAAAGGG + Intergenic
1179840452 21:44069382-44069404 TGGCCGATAAACATGAAAAGGGG + Intronic
1181356975 22:22303588-22303610 TGACACTTAAATTTAAAAAGAGG - Intergenic
1182809401 22:33103120-33103142 TGACACATTCACTTTAAAAAGGG + Intergenic
950013282 3:9738932-9738954 TGACCCATCATCTTTAAGGGAGG + Intronic
950316744 3:12008031-12008053 TTAGCCATGAACCTTAAAAGAGG - Intronic
951277831 3:20711338-20711360 GGACCCATAAAGTAGAAAAGAGG + Intergenic
951342303 3:21503095-21503117 TGCCTCATAAACTTCAACAGAGG + Intronic
951360001 3:21713856-21713878 TGACATGTAAACTTTAAAAAAGG - Intronic
952158411 3:30668919-30668941 TTACACATAAACCTTAAAAATGG + Intronic
952629334 3:35445877-35445899 AGAGCCATAAACTTTGCAAGGGG - Intergenic
953203813 3:40802068-40802090 TGACCCAAAAATTGTCAAAGAGG - Intergenic
955534030 3:59904285-59904307 TGTGCCATAAAATTCAAAAGAGG + Intronic
955768272 3:62367416-62367438 TTTCCCATAACTTTTAAAAGAGG + Intergenic
958116846 3:89231713-89231735 TCAGCCATAAACTTTATAATGGG - Intronic
958796958 3:98716311-98716333 TGGGCCGTAAACTTTAAAGGAGG - Intergenic
959927897 3:111945336-111945358 TAACCCCAATACTTTAAAAGAGG + Exonic
960214504 3:115014909-115014931 TCACCCATAAACTTATAAAGTGG + Intronic
960982097 3:123239112-123239134 TGAAACATATACTTTAAAACGGG - Intronic
964247902 3:154674987-154675009 TGACACATTAACTTTGAAAGTGG - Intergenic
965338275 3:167455080-167455102 AGACTCATAAACTTTGGAAGAGG - Intronic
967054714 3:185822219-185822241 TGACTGATAAACTGTAAAGGTGG + Intronic
967308157 3:188079129-188079151 TTCCACATAAACTTTAAAATCGG - Intergenic
967415356 3:189211537-189211559 TGACCCATAAAGAATACAAGAGG - Intronic
967487741 3:190053780-190053802 GGCCCCATAAAAATTAAAAGTGG - Intronic
967862983 3:194166796-194166818 TGTCCGATAAACTTCCAAAGCGG - Intergenic
971034046 4:22674074-22674096 TGATCCTTAAACAATAAAAGTGG + Intergenic
973005667 4:45002736-45002758 AAATTCATAAACTTTAAAAGTGG - Intergenic
973295522 4:48515670-48515692 TGATTCAAAAACTATAAAAGTGG - Intronic
973833652 4:54787837-54787859 TGACTGATAAAATTTAGAAGTGG + Intergenic
974617850 4:64312919-64312941 TGACCAATTATTTTTAAAAGCGG - Intronic
975829517 4:78354542-78354564 AAACCCATCAATTTTAAAAGTGG + Intronic
977239611 4:94551774-94551796 TGACCCATAAAGGAAAAAAGTGG + Intronic
978054141 4:104242120-104242142 AGACCCATCAACTCTAAAATGGG + Intergenic
979294350 4:119013451-119013473 TGTCCCATAAATTTAAAAAATGG - Intronic
992990996 5:82283297-82283319 TGACCCATAAATATTTGAAGAGG + Intronic
995085015 5:108098402-108098424 TGACCCAAAAAGTTGAAAGGAGG - Intronic
995132996 5:108649869-108649891 TGAGCCACAAATTTTAGAAGAGG - Intergenic
996156275 5:120106477-120106499 TTACCCATCAAATTTAGAAGTGG + Intergenic
996205060 5:120723991-120724013 CTACCCATAATCTTAAAAAGTGG + Intergenic
997426218 5:133804508-133804530 TGACCCCTAAACATTGAAAAGGG + Intergenic
999824430 5:155260331-155260353 TGGCTTATAAACTTTAAAATGGG - Intergenic
1000292923 5:159887981-159888003 TTACTCATAACATTTAAAAGAGG + Intergenic
1000441122 5:161264660-161264682 ACACCCATAATCATTAAAAGTGG - Intergenic
1000967056 5:167670265-167670287 TGATCCTTAAAATTTCAAAGAGG - Intronic
1002125335 5:177039200-177039222 TGGCCCAGAACTTTTAAAAGAGG - Intronic
1004415307 6:15417992-15418014 TGACTCAATAACTTCAAAAGAGG - Intronic
1010528367 6:76932927-76932949 TTCCCCATAAGCTTTAAAAGTGG + Intergenic
1011113427 6:83863599-83863621 TGAACCAGAAACTAGAAAAGAGG - Intronic
1011514520 6:88138348-88138370 TTACCCAGAAACTTTTGAAGTGG + Intergenic
1012594742 6:101026081-101026103 TGACTCAGAAATTTTAAAAAAGG - Intergenic
1012689139 6:102292684-102292706 TGTCCCATATACTTTTAAATTGG - Intergenic
1013878649 6:114866151-114866173 TGATCAATTGACTTTAAAAGAGG + Intergenic
1013989573 6:116237758-116237780 GGGCCCAGAAACTTGAAAAGTGG + Intronic
1015177898 6:130330833-130330855 TGACCTAGAGACTTTATAAGTGG - Intronic
1016894406 6:149038084-149038106 TGACCCAAAACCTTTAAAAGTGG + Intronic
1018708899 6:166483595-166483617 TTACCCTTAATCTTAAAAAGAGG - Intronic
1018739667 6:166717728-166717750 TGACCCAGAAATTTTACCAGGGG + Intronic
1019065544 6:169293084-169293106 TGACATTTAAACTTTAAAAGGGG + Intergenic
1019302484 7:314245-314267 TGGCCTATAAACTTTATAACGGG - Intergenic
1020578065 7:9959269-9959291 TGACATTTAAACTTTAAAACAGG - Intergenic
1020956289 7:14743375-14743397 TGACTCAAAAATTTTAAAATAGG - Intronic
1021913117 7:25405994-25406016 TGGCTCATAAAGTTTATAAGGGG + Intergenic
1026119483 7:67524386-67524408 TTACCCATAAGCTCTAAAAAGGG - Intergenic
1028704754 7:93828366-93828388 TGAACCACAAACTGAAAAAGAGG + Intronic
1030700387 7:112631849-112631871 TTACCCATTACATTTAAAAGAGG - Intergenic
1031267853 7:119604805-119604827 TGACCTGAAAACATTAAAAGTGG + Intergenic
1031745264 7:125488084-125488106 TGACCAGTAATCTTTAAAACTGG + Intergenic
1032504826 7:132427070-132427092 ACACTCACAAACTTTAAAAGTGG + Intronic
1038910743 8:31960813-31960835 TAACACAAAAACTGTAAAAGTGG - Intronic
1039418071 8:37412758-37412780 TGACCCAGAAACTGTAAATAGGG + Intergenic
1039463445 8:37764676-37764698 TGCCCCATTTACTCTAAAAGTGG - Intronic
1040791856 8:51240143-51240165 TGAATAATACACTTTAAAAGAGG - Intergenic
1042669736 8:71247923-71247945 TGGCACATAAATTTTAAAATTGG - Intronic
1045335494 8:101199857-101199879 TTACACATTAACTTAAAAAGGGG + Intronic
1046711213 8:117513795-117513817 TGACTATAAAACTTTAAAAGAGG + Intergenic
1047248420 8:123163831-123163853 TGAATTATAAACTTTAAAAATGG - Intergenic
1047260396 8:123253605-123253627 TCACTCATAAAATTTAAAACTGG - Exonic
1049943108 9:567759-567781 TAACCAATAAATTTTAAAATGGG - Intronic
1053689729 9:40578688-40578710 TGACACTTAAATTTAAAAAGAGG + Intergenic
1054300977 9:63379627-63379649 TGACACTTAAATTTAAAAAGAGG + Intergenic
1058200836 9:102038158-102038180 TGAACCATTAACTTTAAATGAGG + Intergenic
1059833627 9:118126427-118126449 TGATCCCAAAACTTCAAAAGTGG - Intergenic
1061279601 9:129589782-129589804 TGACTTATAAACTCCAAAAGCGG - Intergenic
1061659329 9:132118239-132118261 TGACCCATACACTTTTAGGGAGG - Intergenic
1062209339 9:135355324-135355346 TGATCCATAAATTATAAATGGGG + Intergenic
1188223589 X:27570298-27570320 TGACCTAAAAACTTAAAAATAGG + Intergenic
1191030767 X:55967850-55967872 AAACCCACAAATTTTAAAAGTGG + Intergenic
1193138065 X:77995252-77995274 TGAGCTATAAATCTTAAAAGAGG + Intronic
1193745846 X:85279970-85279992 TAACCCATAGAATTTAAAATTGG - Intronic
1194589631 X:95783415-95783437 TGACTCATACACTCTAAAAGGGG + Intergenic
1194996275 X:100594813-100594835 TGAACCACAATCTTTAAAATAGG - Intronic
1195523648 X:105860135-105860157 TGACCTCTCAACTGTAAAAGGGG - Intronic
1196363179 X:114891300-114891322 GGAAACATAAACTGTAAAAGGGG - Intronic
1201858262 Y:18568932-18568954 TGACCCATAAACTTTAAAAGAGG + Intronic
1201875059 Y:18751449-18751471 TGACCCATAAACTTTAAAAGAGG - Intronic
1202168777 Y:22019133-22019155 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202222584 Y:22567235-22567257 TGACCCATGAATTTTAAAAGAGG + Intergenic
1202320531 Y:23628425-23628447 TGACCCATGAATTTTAAAAGAGG - Intergenic
1202550236 Y:26041631-26041653 TGACCCATGAATTTTAAAAGAGG + Intergenic