ID: 1201858325

View in Genome Browser
Species Human (GRCh38)
Location Y:18569472-18569494
Sequence GCTTTTGGAGTGACCAGAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 2, 1: 7, 2: 12, 3: 21, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201858322_1201858325 8 Left 1201858322 Y:18569441-18569463 CCTCAGATTTTAGCTGAGCAGAG 0: 2
1: 0
2: 1
3: 13
4: 165
Right 1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG 0: 2
1: 7
2: 12
3: 21
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201858325 Original CRISPR GCTTTTGGAGTGACCAGAGC AGG Intronic
900839770 1:5038825-5038847 ACTTTTTCAGTGAACAGAGCTGG + Intergenic
901987766 1:13089755-13089777 GCTTCTGGAGTGACCAGAGCAGG - Intergenic
901994046 1:13137012-13137034 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
904172967 1:28604809-28604831 GCTGTTGGACTGACCAAAGATGG + Intronic
904174615 1:28617837-28617859 GCCTTTTGAGAGACCAAAGCAGG - Intronic
905022108 1:34825257-34825279 GCTTTTGGAGGCAGCAGAGCTGG - Intronic
905061419 1:35142874-35142896 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
907249057 1:53125836-53125858 GCTTCTGGTGTAAACAGAGCTGG - Intronic
907271714 1:53295231-53295253 GCTGTGGGAGTGAAGAGAGCAGG + Intronic
910727805 1:90356910-90356932 AGCTTTGGAGTGACCAGATCTGG + Intergenic
910982520 1:92973146-92973168 GAATTTGGACCGACCAGAGCAGG + Intergenic
915286929 1:154859058-154859080 GCCTTTGGAGGGCTCAGAGCTGG - Intronic
916943902 1:169704718-169704740 GCCTTTGGAGGCCCCAGAGCTGG - Exonic
919282785 1:195512588-195512610 AATTTTGGAGTGACAAGACCTGG - Intergenic
920533381 1:206721614-206721636 GCTTTAGGAGCAGCCAGAGCAGG + Intronic
921569924 1:216765569-216765591 GCCTTTGGAGAGAGTAGAGCAGG - Intronic
1064082801 10:12322136-12322158 GCTTTTGGTTTTTCCAGAGCAGG + Intergenic
1065214446 10:23437307-23437329 GCGGCTGGAGTGACCTGAGCTGG + Intergenic
1065282878 10:24157958-24157980 GATTGTGGAGTCACCAGGGCTGG - Intronic
1067133240 10:43585268-43585290 GCTTCCGGAGTGACCACAGCAGG + Intergenic
1072059933 10:91799418-91799440 GTTTCTGGAGTGACTAGAACGGG + Intronic
1073069753 10:100785839-100785861 GCCTCTGGAGTGAGCACAGCAGG + Intronic
1073581029 10:104665657-104665679 GCTTTTAGAGGGCCCAGAGATGG + Intronic
1075737671 10:124673997-124674019 GCTGTTGGAGTCAGAAGAGCTGG - Intronic
1076473462 10:130736232-130736254 GCTTTAGGAGCGACCAAAGGAGG + Intergenic
1078059512 11:8034100-8034122 GCTCTTGGAATGGCCTGAGCTGG - Intronic
1080189263 11:29525188-29525210 GCTCCTGGGGTGACTAGAGCAGG - Intergenic
1082626681 11:55495571-55495593 GATTTTGGAGGGGCCAGAGGAGG - Intergenic
1082910325 11:58365965-58365987 GTCCATGGAGTGACCAGAGCTGG + Intergenic
1082960992 11:58918766-58918788 GCTTCCAGAGTGACTAGAGCAGG + Intronic
1083344279 11:61978676-61978698 GGATTTGGGGTGACCAGATCAGG + Intergenic
1083629388 11:64087960-64087982 GCTGTTCGAGGGGCCAGAGCTGG + Intronic
1084581495 11:70026777-70026799 GCCTTTGGAGAGTCGAGAGCTGG - Intergenic
1085572868 11:77574348-77574370 GCCTCCGGAGTGACCAGAACAGG - Intronic
1087424586 11:97971009-97971031 CCTTTTGGAGTGACCCAAGTTGG + Intergenic
1088852569 11:113716975-113716997 GATTTTAGATTAACCAGAGCTGG + Intergenic
1089061875 11:115632416-115632438 GATCTGGGAATGACCAGAGCTGG + Intergenic
1089577992 11:119460272-119460294 CCTTCGGGAGTGACCAGACCTGG - Intergenic
1090619258 11:128547122-128547144 CCCTTGGGACTGACCAGAGCAGG + Intronic
1090670641 11:128942880-128942902 GCTTTCGGAGTGAGCTGAGCAGG + Exonic
1091324069 11:134671063-134671085 GCCTTTGCAGTGACCTGAGCGGG + Intergenic
1091835549 12:3583263-3583285 CTTTGTGGGGTGACCAGAGCTGG + Intronic
1091999741 12:5022441-5022463 GCTACTGGAGTGACCACAGAAGG - Intergenic
1095952147 12:47787455-47787477 GGTGGTGGAGTGAGCAGAGCTGG - Intronic
1096042059 12:48526194-48526216 GCTTCTGGAGATATCAGAGCAGG - Exonic
1102199279 12:111046272-111046294 GCTTGCGGAGAGACCAGTGCAGG + Intronic
1109098762 13:58151484-58151506 ACTTTTGGAATGGCCAGAACAGG - Intergenic
1111421748 13:88019662-88019684 GATTTTGGAGGGACCAAAGGTGG + Intergenic
1112367496 13:98767831-98767853 GCTTCCAGAGTGACCAGAGCAGG - Intergenic
1112921963 13:104625184-104625206 GCTTTTTGAGCAACCAGACCTGG - Intergenic
1114574136 14:23696994-23697016 GCCTCTGGAGTGACCAGAGCAGG - Intergenic
1118951388 14:70439439-70439461 GCTTCTGGAGTGACCAGAGCAGG + Intergenic
1120689658 14:87578413-87578435 GCTTTGGAAGTCACCAGAGTGGG - Intergenic
1126198762 15:45961475-45961497 ACTTTTGTACTGAGCAGAGCAGG + Intergenic
1128335559 15:66783715-66783737 GCTTCTGGGCTGACCACAGCTGG + Intergenic
1128600645 15:68992812-68992834 GCTTCTGGGGTGACTAGAGCAGG + Intronic
1128600652 15:68992877-68992899 GCTTTCGGAGTGACCAGAGCAGG + Intronic
1128730126 15:70015269-70015291 GCTTGTGGAGCTAGCAGAGCAGG - Intergenic
1128976239 15:72155876-72155898 GCCTTCCGAGTGGCCAGAGCTGG + Intergenic
1131071855 15:89471103-89471125 CCTGCTGGAGTGCCCAGAGCAGG + Intergenic
1131394867 15:92078247-92078269 GCTTTTGGGAGCACCAGAGCTGG + Intronic
1132845175 16:1997911-1997933 GCTTTGGGAGGGCCCAGATCAGG + Exonic
1133069615 16:3236068-3236090 CCTATGGGAGTCACCAGAGCGGG - Intronic
1133279066 16:4655031-4655053 GCATTTGGAGTGACCAGGGCAGG + Intronic
1133678270 16:8096368-8096390 GCTTCAGCTGTGACCAGAGCTGG - Intergenic
1134912714 16:18042515-18042537 GCTTTTGGAGGAACCTGAGAAGG + Intergenic
1140557955 16:75943278-75943300 GCTATCAGAGTGATCAGAGCAGG + Intergenic
1147790557 17:43012082-43012104 GCTTTTGGAGCGTCCAGAATAGG + Intronic
1149321234 17:55483502-55483524 GCTTTTCGACTGACTAGAGGAGG - Intergenic
1152421952 17:80198355-80198377 GCTTGTGCACTGCCCAGAGCAGG - Intronic
1157321422 18:46637425-46637447 GATTTTTGAGTGACCAAAGCAGG + Intronic
1158900521 18:61957819-61957841 GCTGTTGGAGTTCCCATAGCTGG + Intergenic
1160714061 19:567493-567515 GCTTCCGGGGTGACTAGAGCAGG + Intergenic
1162907256 19:13831308-13831330 GCTTTTGGGGTGCCCAAAGTGGG - Exonic
1163205603 19:15800344-15800366 GCTTTTTGAGTGAATACAGCAGG + Intergenic
1163250632 19:16124574-16124596 CCTTGTGGAGTGCCCACAGCGGG - Intronic
1163315533 19:16538215-16538237 GTTCTTGGAGTGGCCAGAGGTGG - Intronic
1163863986 19:19757055-19757077 GATTTGGGAGAGACCAGAGGTGG - Intergenic
1163953795 19:20615196-20615218 GCCTCTGGAGTGACCAGAGCAGG - Intronic
1164033596 19:21433819-21433841 GCTTCCAGAATGACCAGAGCAGG + Intronic
1164128754 19:22342646-22342668 CCTTTTGGAGGGACCAAGGCAGG - Intergenic
1164142573 19:22486311-22486333 GCTTCCGAAGTGACCAGAGCAGG + Intronic
1164148598 19:22529186-22529208 GCCTCCGGAGTGACCAGGGCAGG - Intronic
1164286101 19:23819219-23819241 GCTTCTGGGGTGACTAGAACAGG + Intronic
1164286107 19:23819283-23819305 GCTTCTGAAGTGACCAGAGCAGG + Intronic
1167019743 19:46864113-46864135 GCTTTTTGAGTGACCTGATTGGG + Intergenic
1167999802 19:53436020-53436042 GCCTCCAGAGTGACCAGAGCAGG + Intronic
1168004236 19:53473397-53473419 GCCTCCAGAGTGACCAGAGCAGG + Intronic
925164129 2:1705233-1705255 GGTTTGGGAGTGAACTGAGCCGG - Intronic
926163859 2:10505946-10505968 GGTTTTGGAATTACTAGAGCAGG - Intergenic
927170758 2:20367492-20367514 GATTTAGGAGGGACCAGAGGTGG - Intergenic
928449048 2:31362125-31362147 CCTTTTGGGGTGAGTAGAGCAGG + Intronic
929936220 2:46296590-46296612 GATCTTGGAGTGACAAGAGTTGG - Intronic
931013511 2:57947468-57947490 GCTGTTGGAAAGACCAGGGCAGG - Intronic
931596730 2:63954029-63954051 GCTTTTGTAGTGGACAGAACTGG - Intronic
933325819 2:80835722-80835744 GCATTTGGAGTGAGGAGACCTGG + Intergenic
934158946 2:89230110-89230132 GAACTTTGAGTGACCAGAGCGGG + Intergenic
934656697 2:96120097-96120119 GATTTAGGTTTGACCAGAGCTGG - Intergenic
935763717 2:106344341-106344363 GCTTTTGGAGAGGCGAGAGGCGG + Intergenic
936056185 2:109264007-109264029 GCTTCTGGAGTGTCCTGACCAGG - Intronic
937173146 2:119897427-119897449 GCTTTTTAAGTGAACAGAGTTGG + Intronic
938126361 2:128675633-128675655 GCTATTGGAGAGGCTAGAGCAGG - Intergenic
938713939 2:134001551-134001573 GGTCTTGGAGTCACCTGAGCTGG + Intergenic
940865323 2:158812140-158812162 GCTTTTGGGGTGCCCAGAGCAGG - Intronic
943069913 2:183128376-183128398 GGTTGTGGAGTCACCGGAGCTGG - Exonic
948454883 2:238100325-238100347 GCTTATCGGGTAACCAGAGCCGG + Exonic
948784667 2:240346138-240346160 GCTTGTGGAGTGACCCGGCCAGG - Intergenic
1169477574 20:5946447-5946469 GCATTTGAAGTGACCAGTGGAGG - Exonic
1171205805 20:23279999-23280021 ACGTTTGGAGGAACCAGAGCTGG - Intergenic
1171951019 20:31422389-31422411 ACTTTCTCAGTGACCAGAGCTGG - Intergenic
1172301825 20:33855769-33855791 GCTTCTGGGTTCACCAGAGCTGG - Intergenic
1173112338 20:40203761-40203783 GCTCTTGGAGCTACCAGAACAGG - Intergenic
1174417680 20:50378279-50378301 GAAGTTGGAGTGACCAGGGCTGG - Intergenic
1176170598 20:63694767-63694789 GGGTCTGGAGTGCCCAGAGCAGG + Exonic
1179086823 21:38225723-38225745 GCTTCTGGAGTGACCAGAGCAGG + Intronic
1179511980 21:41879272-41879294 GCCTTTGGAATGTGCAGAGCGGG + Exonic
1180055470 21:45356814-45356836 GCTTTGGGAGAGACAGGAGCAGG - Intergenic
1182583968 22:31332553-31332575 GCTTCTGGAGTGCCAAGTGCAGG - Intronic
1183031320 22:35108520-35108542 CCTATTGGAGTGATCAGAGGAGG - Intergenic
1183718775 22:39550090-39550112 CCGTTTGTAGAGACCAGAGCTGG - Intergenic
1184943321 22:47784142-47784164 GCGTGGGGAGTGACCAGGGCCGG - Intergenic
949949603 3:9218209-9218231 GCTCTAGGAGAGACCACAGCTGG + Intronic
950098550 3:10343981-10344003 GCTTTGGGAGAGAACAGAGGTGG - Intronic
953582270 3:44167729-44167751 GCTTCTGGAGAGAACAGGGCTGG - Intergenic
953957945 3:47245976-47245998 GCTCTGAGAGTGCCCAGAGCAGG - Intronic
954612515 3:51953447-51953469 GCTCTTGGAGGGATGAGAGCTGG + Intergenic
955582727 3:60442154-60442176 CCTTTCAGAGTGACCAGGGCTGG - Intronic
956070207 3:65441205-65441227 GCATTTGGGGAGACCAAAGCAGG - Intronic
960634890 3:119774945-119774967 GGTTCTGGAGGGAGCAGAGCAGG + Intergenic
961715654 3:128855752-128855774 GCTTCTGGAGTCACCAGAGCAGG + Intergenic
962271935 3:133983818-133983840 GCTTTGGGAGAGACGAGGGCTGG + Intronic
964020859 3:152008661-152008683 GCTTTTCTAGTGAACAGAGAGGG + Intergenic
964902389 3:161675403-161675425 GCTTTTTGGGAGAGCAGAGCAGG + Intergenic
964912500 3:161800130-161800152 GATTTTGGAGGGGCCAGAGGTGG - Intergenic
965923272 3:173945371-173945393 GCCTCTGGAGTGTGCAGAGCTGG + Intronic
967412396 3:189180241-189180263 GATTTGGGAGCGACCAGAGGTGG - Intronic
968380562 4:92423-92445 GATTTGGGAGTGACCAAAGGTGG - Intergenic
969647242 4:8438909-8438931 GCCTCCGGAGTGACCAGAGCAGG - Intronic
970291517 4:14578061-14578083 GCTCTTTAAGTGACCAGAGAAGG + Intergenic
970356316 4:15256707-15256729 GGCTTTTGAGTGACCAGACCTGG + Intergenic
971994352 4:33945474-33945496 GAATTTGCAGTGACCAGAGATGG - Intergenic
972480185 4:39489304-39489326 GCTTCTGGAGTGACTAGAGCAGG - Intergenic
974976549 4:68901219-68901241 GCTTCCGGAGTGACCAGAATAGG + Intergenic
974989098 4:69062752-69062774 GTTCTTGGTGTGACTAGAGCAGG - Intronic
975512340 4:75207806-75207828 GATTTTGGAATGATCAGACCTGG - Intergenic
977611847 4:99043703-99043725 GGTTTTGAAGAGACCAGGGCAGG + Intronic
978467429 4:109023280-109023302 GCTGTTGGAGTGACTAAATCTGG + Intronic
979058031 4:116018946-116018968 GCTTCCAGAGTTACCAGAGCAGG - Intergenic
979058036 4:116019010-116019032 GCTTCCGGGGTGACTAGAGCAGG - Intergenic
981164817 4:141545277-141545299 GGTTATGGTGTGATCAGAGCTGG - Intergenic
984217022 4:176926340-176926362 ATTTTTGAAGTGACCACAGCAGG + Intergenic
988019923 5:25609105-25609127 ACTTTTGGGGTGACCTGAGATGG + Intergenic
988718414 5:33851575-33851597 GCTTTGGCAATGACCAGAGGAGG - Intronic
990006841 5:50954073-50954095 GCTTTTGGAGTTCCTGGAGCAGG + Intergenic
990727981 5:58777388-58777410 GTTTTTGAAGTGACCAAGGCAGG - Intronic
993253039 5:85552989-85553011 GATTTGGGAGGGACCAGAGGTGG - Intergenic
994973091 5:106768314-106768336 GCTCTTGTAGTGATCAAAGCAGG + Intergenic
996110125 5:119555674-119555696 GTGTGTGGAGTGAGCAGAGCAGG + Intronic
998375547 5:141688229-141688251 GCTTTGGGAGTGACCAGAGGGGG + Intergenic
998401058 5:141849443-141849465 GCTTTCGGAGAGACCCGAGTTGG - Intergenic
1001298345 5:170515114-170515136 GCTTTGGAAGTGGCCAAAGCTGG - Intronic
1002200495 5:177525094-177525116 GCTCTTGGAGTGGCCCGACCGGG - Exonic
1003317673 6:5026694-5026716 GCCTATGGAGTCACCAGGGCAGG - Intergenic
1004051227 6:12081597-12081619 GGTTTTGGAGAAAGCAGAGCAGG - Intronic
1004503311 6:16227755-16227777 GCCTCCGGAGTGAGCAGAGCAGG + Intergenic
1006037773 6:31227315-31227337 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1008261380 6:49369963-49369985 CCTTTTAGAGTTACCAAAGCAGG - Intergenic
1008347184 6:50442131-50442153 TCTTTTGGAGTGACCTGACAAGG - Intergenic
1008583346 6:52926068-52926090 GCCTCCAGAGTGACCAGAGCAGG - Intergenic
1010320935 6:74509126-74509148 ACTTTTACAGTGACCAGATCTGG + Intergenic
1011299977 6:85863760-85863782 GCCTCCGGAGTGACCAGAGCAGG + Intergenic
1011378532 6:86718194-86718216 GATTTGGGAGTGACCAGGGGTGG - Intergenic
1012629071 6:101441171-101441193 GCTTTTGGAAAGAGCTGAGCTGG - Intronic
1013411531 6:109888148-109888170 GCTTCTGGGGTGACTGGAGCAGG + Intergenic
1016058456 6:139603229-139603251 ATGTTTGGAGTGAGCAGAGCTGG - Intergenic
1016272105 6:142301667-142301689 GCTTTTGGAGCGAGCAGCGAAGG - Intergenic
1022025316 7:26443050-26443072 GCTTTCAGAGAGACCACAGCGGG + Intergenic
1023098606 7:36689645-36689667 GATTTTGGAGAGACCATAACAGG + Intronic
1025823535 7:64993186-64993208 GCTTCTGGGGTGACTAGAGCAGG + Exonic
1025823542 7:64993250-64993272 GCTTCCGGAGTGACCAGAGCAGG + Exonic
1028400612 7:90421423-90421445 GCTTTGGCAGGGAACAGAGCAGG + Intronic
1029364293 7:100107292-100107314 GCTTTTGGAGTCCCTGGAGCTGG + Exonic
1031275127 7:119712009-119712031 GATTTGGGAGGGACCAGAGGTGG - Intergenic
1032571506 7:133004554-133004576 GCTTTCTGAGAGGCCAGAGCAGG + Intronic
1033109153 7:138559552-138559574 GCTTCTGGGGTGACTAGAGCCGG + Intronic
1033365065 7:140666710-140666732 GCTTCCGGAGTGACCAGAGCAGG - Intronic
1035412573 7:158656910-158656932 GCTTCTTCAGTGTCCAGAGCTGG - Intronic
1038152235 8:24953065-24953087 GCTTTTGGAGAGAGTGGAGCTGG - Intronic
1038264032 8:26023135-26023157 TCTATTGGAGTGAACAGGGCTGG - Intronic
1039427748 8:37500768-37500790 GCTTTTGGAGTGGCCAGGCAGGG + Intergenic
1039443352 8:37611058-37611080 GCTTTGGAAGTGCTCAGAGCTGG - Intergenic
1039572931 8:38601618-38601640 GGCTTTGGAGTGACGAGGGCTGG + Intergenic
1040540188 8:48346885-48346907 GATTTTGGAGGGGCCAGAGGTGG + Intergenic
1041099022 8:54378209-54378231 CCTCTTGGAGTGACCAGTGAGGG - Intergenic
1043863046 8:85343527-85343549 GCTCATGGAGTGACAGGAGCAGG + Intronic
1044304040 8:90617293-90617315 GATTTGGGAGTGGCCAGAGGTGG + Intergenic
1045695438 8:104804043-104804065 GCTTTTGGAGTCACCAAATATGG - Intronic
1049439532 8:142602818-142602840 GATTCTGGAGGGACCAGAGGGGG + Intergenic
1052037770 9:23702483-23702505 GCTAGTGGGGTGACCACAGCTGG + Intronic
1052382837 9:27789916-27789938 GATTTTGGAGGGACCAGGGGTGG + Intergenic
1054717608 9:68572068-68572090 GCTTGTGTAGTGATCAGAACGGG - Intergenic
1055256826 9:74381682-74381704 GCATTTGAAGTGACCAAAGAAGG + Intergenic
1058011127 9:99978403-99978425 GGTTTTGGAGTCACCAGAAGAGG - Intergenic
1061305142 9:129728113-129728135 GCAGTTGGAGAGGCCAGAGCGGG - Intergenic
1061794602 9:133078649-133078671 GCCTCACGAGTGACCAGAGCAGG + Intronic
1191718299 X:64207853-64207875 GTTTTTGGAGTGACTAGTGTGGG + Intergenic
1193978857 X:88157315-88157337 GCTGTTGCAGTGAGCAGAGATGG - Intergenic
1194090806 X:89580687-89580709 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1194090813 X:89580751-89580773 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1194379246 X:93174654-93174676 GCCTTTGGAGGGCCAAGAGCAGG + Intergenic
1198469416 X:136932367-136932389 GCCTCTGGAGTGACCAGAGCAGG + Intergenic
1199642947 X:149881451-149881473 GAGCTTGGTGTGACCAGAGCAGG + Intronic
1200443458 Y:3236747-3236769 GCTTCTGGGGTGACTAGAGCAGG + Intergenic
1200443465 Y:3236811-3236833 GCTTCCGGACTGACCAGAGCAGG + Intergenic
1201858325 Y:18569472-18569494 GCTTTTGGAGTGACCAGAGCAGG + Intronic
1201860304 Y:18590490-18590512 GCTTTTGGAGGGACCAGAGCAGG + Intergenic
1201873019 Y:18729891-18729913 GCTTTTGGAGGGACCAGAGCAGG - Intergenic
1201874996 Y:18750909-18750931 GCTTTTGGAGTGACCAGAGCAGG - Intronic
1202095245 Y:21243014-21243036 GCTTGTGGTGTGACTAGGGCAGG + Intergenic
1202168721 Y:22018600-22018622 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202222640 Y:22567768-22567790 GCTTTCGGAATGACCAGAGTAGG + Intergenic
1202320475 Y:23627892-23627914 GCTTTCGGAATGACCAGAGTAGG - Intergenic
1202550292 Y:26042164-26042186 GCTTTCGGAATGACCAGAGTAGG + Intergenic