ID: 1201859569

View in Genome Browser
Species Human (GRCh38)
Location Y:18581815-18581837
Sequence TTCCATTTGACACCTGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 2, 1: 0, 2: 0, 3: 15, 4: 122}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201859569 Original CRISPR TTCCATTTGACACCTGTGGC TGG (reversed) Intronic
901126725 1:6934607-6934629 TTCCAGGGGAGACCTGTGGCCGG + Intronic
901948048 1:12719376-12719398 CTCCTTTTGCCACCTGTGGAGGG + Intronic
903521677 1:23955441-23955463 TTCCATTTCACTCTTCTGGCAGG + Intergenic
905793283 1:40801637-40801659 TACCATCTGGCACCTGTGCCTGG + Intronic
906509671 1:46403723-46403745 TTCCATTCGCCACCTGAGGTAGG + Intronic
908392031 1:63692091-63692113 TTCCATTTGTCACCAGTAGAAGG + Intergenic
910669928 1:89762722-89762744 TTCCATTTCAGACCTGGGACTGG + Intronic
915309834 1:155001395-155001417 TTCCATTTGACACTAGTGGGAGG + Intergenic
918884787 1:190177847-190177869 TTCTATTTTCCACCTGTAGCTGG - Intronic
919493402 1:198234115-198234137 TTCAATTTCTCACCTGTAGCAGG + Intronic
1062811832 10:472388-472410 GTCCATCTGCCACCTGTGCCAGG - Intronic
1069856269 10:71442870-71442892 GTGCATGGGACACCTGTGGCCGG + Intronic
1071814870 10:89222335-89222357 TTGCTTTTGATACCTGTGGTGGG - Intronic
1076865257 10:133163438-133163460 GTCCATATGACATCTGTGCCAGG + Intronic
1078893001 11:15574316-15574338 TTTCTTTTGACACCTGTGCTAGG - Intergenic
1081050365 11:38332657-38332679 TGCCATTTGCCACCTGTGTCTGG + Intergenic
1081866308 11:46362354-46362376 ACCCAGGTGACACCTGTGGCCGG + Intronic
1083356470 11:62070022-62070044 TTCCAGTTGGCTCCTGGGGCTGG + Intergenic
1085463590 11:76709702-76709724 TTCCATTTGACAACCCTGGGAGG - Intergenic
1088994103 11:114981455-114981477 TTGCATTTTATACCTATGGCAGG + Intergenic
1090093650 11:123723073-123723095 TCCCATTTTTCGCCTGTGGCAGG + Intergenic
1090152639 11:124401936-124401958 CTCCATGTGACAGCTGTAGCTGG + Intergenic
1090826327 11:130389211-130389233 TTCCTATTGACATCTGTGTCAGG + Intergenic
1091091526 11:132775779-132775801 TCCCATATGACACCTGTCGATGG - Intronic
1091221479 11:133932102-133932124 TTCCACTTGACCACGGTGGCCGG + Exonic
1091291255 11:134441105-134441127 TTACATTTGGCATCTGTGGATGG + Intergenic
1092265704 12:6978754-6978776 TTCCTTTTCACACTTGTGGCTGG + Intronic
1093334457 12:17885456-17885478 TTCCATTTGAGATCCGTGGTGGG - Intergenic
1097319422 12:58208779-58208801 CTCCATTAGACACCTGGGCCAGG + Intergenic
1098532123 12:71553130-71553152 TTCCCTGAGGCACCTGTGGCTGG + Exonic
1106468381 13:30033209-30033231 TCCCCTTTGTCACCTGTGGGTGG - Intergenic
1107065716 13:36212903-36212925 TTCCATTTGCAATCTGTGGCAGG + Intronic
1111818068 13:93179883-93179905 TTCCATTTACCTCCTTTGGCAGG + Intergenic
1112823571 13:103365018-103365040 TTCCCTTTGCTACCTTTGGCAGG - Intergenic
1114129821 14:19777995-19778017 TTCCACTTGACACTTGTGAAGGG + Intronic
1114261751 14:21042079-21042101 TTTCAGTTGACACCTGGGTCAGG + Intronic
1118926190 14:70191816-70191838 TTCCTCTTGTCACCTGTGACAGG + Intergenic
1120531576 14:85638498-85638520 TTGCAGCTGACACCTGTGGAAGG - Exonic
1122645029 14:103188688-103188710 ATCCATTTGTCAACTGTGGGAGG + Intergenic
1123087561 14:105723838-105723860 GTCCATTTGGTGCCTGTGGCTGG + Intergenic
1123573101 15:21635704-21635726 TTCCACTTGACACTTGTGAAGGG + Intergenic
1123609722 15:22078323-22078345 TTCCACTTGACACTTGTGAAGGG + Intergenic
1128411358 15:67401637-67401659 TTCCCTTTGACAAATGTGACTGG + Intronic
1132339532 15:101069210-101069232 TTCCATCTGAGACCTGGGGATGG - Exonic
1202981964 15_KI270727v1_random:370117-370139 TTCCACTTGACACTTGTGAAGGG + Intergenic
1135876984 16:26211382-26211404 TTCCATTTGAAATCTGGGGCAGG - Intergenic
1135945626 16:26862427-26862449 TTCCATTTGATACCTGGGACAGG + Intergenic
1136506775 16:30709491-30709513 GTCCCTTTCACATCTGTGGCAGG + Exonic
1138248357 16:55483693-55483715 TTCCATCTGTCACTTCTGGCTGG - Intronic
1139926868 16:70493428-70493450 TTTCAATAGCCACCTGTGGCTGG + Intronic
1140183978 16:72750332-72750354 TTCCATATGAAACCAGGGGCCGG + Intergenic
1141057369 16:80831028-80831050 TTCCATTTTACACATGAGGGAGG + Intergenic
1143176663 17:4959498-4959520 CTCCCTTTGACCCCTGGGGCAGG - Exonic
1144776404 17:17787181-17787203 TCCCATCTGACCCCTGTGCCAGG + Intronic
1146224054 17:31050730-31050752 TTTCATTTGATTCCTGGGGCAGG + Intergenic
1147016381 17:37495161-37495183 CTCCATTTTCCACCTGTTGCAGG + Intronic
1150333652 17:64314268-64314290 TTCCATTGGGCCCCTGTGGCAGG - Intergenic
1152925277 17:83084791-83084813 GTCCGTGTGGCACCTGTGGCCGG + Intronic
1156153212 18:34267423-34267445 TTTAATTTGACTCATGTGGCTGG - Intergenic
1157967986 18:52230587-52230609 TTTCTTTTTTCACCTGTGGCAGG + Intergenic
1159851305 18:73529947-73529969 CTCCATTTCAGAGCTGTGGCTGG + Intergenic
1166933723 19:46318188-46318210 TTCCAAATGACATATGTGGCTGG - Intronic
1167991058 19:53361011-53361033 TTCCATGTGACATCTGTGGGCGG - Intergenic
934924231 2:98370608-98370630 TTCCATTTCCTACCTGTGTCAGG - Intronic
937043622 2:118839031-118839053 ACCCATCTGTCACCTGTGGCAGG - Intergenic
939260799 2:139806320-139806342 ATTCTTTGGACACCTGTGGCAGG - Intergenic
939619895 2:144406120-144406142 TTCTCTTTGGCAACTGTGGCAGG + Intronic
941341963 2:164317540-164317562 TTCCATCTGAAACCTTTGGCTGG + Intergenic
944209988 2:197197213-197197235 TTCCCTTTGACATCTGTCACTGG - Intronic
944283963 2:197926858-197926880 TTTCATTTGACAGCTGGGGCAGG + Intronic
945143726 2:206714724-206714746 GTCCTTGTCACACCTGTGGCTGG - Intronic
1169059083 20:2647907-2647929 TTGCATTTTACACCTCTAGCAGG + Intergenic
1174142484 20:48425663-48425685 TTCCATGAGCCACCAGTGGCAGG + Intergenic
1176151231 20:63592056-63592078 GTCCATCTGGCACTTGTGGCTGG + Exonic
1179508942 21:41859541-41859563 TTCCATATGCCAGCTGCGGCAGG - Intronic
1181271549 22:21661515-21661537 TTCCATTTCTCATATGTGGCTGG - Intronic
1182835822 22:33340604-33340626 CTCCATGGGACACCTGTGACGGG + Intronic
949732600 3:7131241-7131263 TTCCATTTGACATTTGAAGCAGG - Intronic
949825570 3:8161684-8161706 TTTCTCTTGACACTTGTGGCAGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957234716 3:77571546-77571568 TTCAAATTGAGACCTATGGCTGG + Intronic
962622334 3:137192231-137192253 TTCCTCTTTTCACCTGTGGCAGG - Intergenic
966840499 3:184083574-184083596 TTCCATTTTCCAACTGTGGGAGG - Intergenic
968918437 4:3509038-3509060 TTTCATTTGTCACCTGTGCGTGG - Exonic
968950499 4:3688897-3688919 TGCAATTTGAAACATGTGGCCGG - Intergenic
971512914 4:27449159-27449181 CTCCAATAGAAACCTGTGGCGGG + Intergenic
975702752 4:77082377-77082399 TGCCATTTGGCACCTGGGTCTGG + Intergenic
977692879 4:99935710-99935732 TTCCTTTTGGCATCTGGGGCTGG + Intronic
979172100 4:117612897-117612919 TTTCATTTGACAACTTTGTCAGG - Intergenic
982418988 4:155171648-155171670 TTCCATTAGCCACTTATGGCTGG - Intergenic
983187646 4:164718691-164718713 TCCCATTTGCCAGCAGTGGCAGG + Intergenic
983644042 4:169971885-169971907 TTCCAAATGACGACTGTGGCTGG + Intergenic
985560415 5:583310-583332 TGCCCTTGGACACCTGTGGACGG + Intergenic
987927342 5:24359971-24359993 ATCTATTTGACACATATGGCAGG - Intergenic
994357417 5:98809515-98809537 TACCACTTGACAGCTGTGGCAGG + Intergenic
995135026 5:108671656-108671678 TCCCTTTTGCCACCTATGGCAGG + Intergenic
996220805 5:120930712-120930734 TTCAATTTGAGACATGTGGATGG - Intergenic
997748909 5:136325926-136325948 TTCCATCTGACACTGGTGGAAGG - Intronic
998484014 5:142486085-142486107 TTCCATCTGACACCTCTGATGGG - Intergenic
999622388 5:153486382-153486404 CTCCATTTGACAGCAGGGGCTGG - Intergenic
999831479 5:155324325-155324347 TTCCATTTCACAGATGTGGAAGG - Intergenic
1000023372 5:157338085-157338107 TTCCTTTTGATAGCAGTGGCGGG + Intronic
1000617613 5:163446264-163446286 TTCGATTTAACATTTGTGGCTGG + Intergenic
1004651470 6:17613829-17613851 ATACATTTGACACCTGTTGAGGG - Intergenic
1005153403 6:22777817-22777839 TGCCATTTGCCACCAGTAGCTGG - Intergenic
1009478378 6:64124152-64124174 TTTCATTTGAAAGCTGTAGCCGG + Intronic
1011090170 6:83588933-83588955 TCCCATTTGAGATCTGTGGCAGG + Intronic
1015380214 6:132558707-132558729 TTCCAATTGAGACCTCTTGCGGG + Intergenic
1016607148 6:145943187-145943209 TTCCATCTGTCACCAGTGGGTGG - Exonic
1018503610 6:164440726-164440748 TTCCATTTGAAACCTGCCACAGG + Intergenic
1019618706 7:1979106-1979128 TTCCAGTTTTCACCTGTGGATGG - Intronic
1020029213 7:4921011-4921033 TTGAAATTGACACCTGAGGCTGG - Intronic
1022673439 7:32477020-32477042 TTCCATCTGACACCTGTGTTGGG - Intergenic
1024939137 7:54744336-54744358 GACCATTAGACTCCTGTGGCTGG + Intergenic
1028582161 7:92419903-92419925 TTCCAAGTCACACCTGTGGTGGG + Intergenic
1030317818 7:108134147-108134169 TGCCATTTGATACCTGAGACTGG - Intergenic
1032263731 7:130356153-130356175 GTCCATTTTGCATCTGTGGCTGG + Intronic
1032265297 7:130366237-130366259 TTCCTCTTGACTCCTGGGGCTGG - Intronic
1033279545 7:139995968-139995990 TTATATTTGTCAACTGTGGCAGG - Intronic
1033621240 7:143063601-143063623 TTCTATGTGACACCTGTGAGAGG + Intergenic
1034652963 7:152706713-152706735 TTCCATTTGATTCCTATGGCCGG - Intergenic
1034815961 7:154172161-154172183 GTTCATTAAACACCTGTGGCAGG - Intronic
1041107211 8:54454921-54454943 TTACATGTGGCATCTGTGGCTGG + Intergenic
1042100057 8:65266108-65266130 GTCCATTTGACACCTATGCTTGG + Intergenic
1042206145 8:66331849-66331871 TTCCATCTGAGTCCTGAGGCTGG - Intergenic
1047895247 8:129359392-129359414 TTCCATTTATCACCTTTGGCTGG - Intergenic
1048047298 8:130784959-130784981 TGCCATTTAACACCAGTGCCTGG + Intronic
1051441165 9:17084766-17084788 TCCCATTTAACACTTGTGGATGG - Intergenic
1052915962 9:33924542-33924564 ATCCATTTGACACCACAGGCAGG + Intronic
1057096918 9:92319243-92319265 TTCCATATGAAAGCTGTGCCAGG - Exonic
1057950130 9:99363312-99363334 ATCCTTTTGACAGCTGTGGGAGG + Intergenic
1058175706 9:101734640-101734662 TTCCATTTAAGAGTTGTGGCAGG + Intronic
1059976127 9:119719136-119719158 CTCCATTTGACAGATGAGGCTGG - Intergenic
1061733964 9:132639464-132639486 TTCCATGTGGCACCTGGGACTGG + Intronic
1188991930 X:36831639-36831661 TTCTATTAGAAACCTGTAGCAGG + Intergenic
1189539284 X:41969636-41969658 TTCGAGTTGACACTTGTGACGGG - Intergenic
1193104494 X:77653967-77653989 TTACATTTTACACTTGTGGAAGG - Intronic
1201859569 Y:18581815-18581837 TTCCATTTGACACCTGTGGCTGG - Intronic
1201873752 Y:18738566-18738588 TTCCATTTGACACCTGTGGCTGG + Intronic