ID: 1201864760

View in Genome Browser
Species Human (GRCh38)
Location Y:18637886-18637908
Sequence CAGTTATAGGAGAAGGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201864760_1201864768 19 Left 1201864760 Y:18637886-18637908 CCTCCAGCCTTCTCCTATAACTG No data
Right 1201864768 Y:18637928-18637950 GCAGTTTCCTCAGTCAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201864760 Original CRISPR CAGTTATAGGAGAAGGCTGG AGG (reversed) Intergenic
No off target data available for this crispr