ID: 1201868562

View in Genome Browser
Species Human (GRCh38)
Location Y:18682492-18682514
Sequence CAGTTATAGGAGAAGGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201868554_1201868562 19 Left 1201868554 Y:18682450-18682472 CCAAAGCTGACTGAGGAAACTGC No data
Right 1201868562 Y:18682492-18682514 CAGTTATAGGAGAAGGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201868562 Original CRISPR CAGTTATAGGAGAAGGCTGG AGG Intergenic
No off target data available for this crispr