ID: 1201870788

View in Genome Browser
Species Human (GRCh38)
Location Y:18705196-18705218
Sequence ATTTGTAATATGAAGATGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201870781_1201870788 5 Left 1201870781 Y:18705168-18705190 CCCTAAAAAACTGGCCCTCCCAC No data
Right 1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG No data
1201870784_1201870788 -10 Left 1201870784 Y:18705183-18705205 CCTCCCACATTACATTTGTAATA No data
Right 1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG No data
1201870782_1201870788 4 Left 1201870782 Y:18705169-18705191 CCTAAAAAACTGGCCCTCCCACA No data
Right 1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG No data
1201870783_1201870788 -9 Left 1201870783 Y:18705182-18705204 CCCTCCCACATTACATTTGTAAT No data
Right 1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG No data
1201870780_1201870788 6 Left 1201870780 Y:18705167-18705189 CCCCTAAAAAACTGGCCCTCCCA No data
Right 1201870788 Y:18705196-18705218 ATTTGTAATATGAAGATGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201870788 Original CRISPR ATTTGTAATATGAAGATGCA GGG Intergenic
No off target data available for this crispr