ID: 1201873016

View in Genome Browser
Species Human (GRCh38)
Location Y:18729823-18729845
Sequence CCATCATGGTTTGCTGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201873010_1201873016 18 Left 1201873010 Y:18729782-18729804 CCCACTGCTGTTAAAATTGCAGG No data
Right 1201873016 Y:18729823-18729845 CCATCATGGTTTGCTGAAACAGG No data
1201873009_1201873016 23 Left 1201873009 Y:18729777-18729799 CCACTCCCACTGCTGTTAAAATT No data
Right 1201873016 Y:18729823-18729845 CCATCATGGTTTGCTGAAACAGG No data
1201873012_1201873016 17 Left 1201873012 Y:18729783-18729805 CCACTGCTGTTAAAATTGCAGGA No data
Right 1201873016 Y:18729823-18729845 CCATCATGGTTTGCTGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201873016 Original CRISPR CCATCATGGTTTGCTGAAAC AGG Intergenic
No off target data available for this crispr