ID: 1201875369

View in Genome Browser
Species Human (GRCh38)
Location Y:18754156-18754178
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 6, 1: 0, 2: 1, 3: 25, 4: 264}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201875369 Original CRISPR GGAAACTGCCCAGCAGAGAC AGG (reversed) Intronic
900200042 1:1400407-1400429 AGTAACTGCCCAGCTCAGACGGG + Intronic
900319517 1:2075664-2075686 GGAAACATCGCAGCAGAGCCCGG - Intronic
900483711 1:2911436-2911458 GTTAACGGGCCAGCAGAGACAGG - Intergenic
901011840 1:6206637-6206659 GGAAACAGTCCAGAAGACACGGG - Exonic
901590908 1:10341644-10341666 GTAAAATACCCAGCAGATACTGG + Intronic
902653565 1:17852509-17852531 GGAACCTGCCCATCTGAGCCTGG - Intergenic
903388077 1:22942851-22942873 GGGAACTGCCCTGTAGAGAAGGG + Intergenic
903441938 1:23394782-23394804 GGCAAATTCCCGGCAGAGACAGG + Intronic
903916512 1:26768563-26768585 GGAAGCTTCCCAGTAGAGATAGG + Intronic
906676268 1:47695726-47695748 GGCAGGTGCCCAGCAGAGGCTGG + Intergenic
908157342 1:61367516-61367538 GGCACCTGCCCATTAGAGACTGG + Intronic
908315095 1:62924657-62924679 GGATCCTGCTCAGCTGAGACGGG - Intergenic
908505500 1:64794113-64794135 AGAAACTGCCCAGCTGGGCCAGG + Intronic
912309958 1:108610212-108610234 GGAAACGATCCAGCAGAGAAGGG + Intronic
917550789 1:176026125-176026147 GAAAACTGCCTAGCAGATAGCGG + Intronic
919797828 1:201331986-201332008 GGACACTGCCCCGCACAGATTGG - Exonic
920300201 1:204983766-204983788 GGAAACTACCCAGCACAGGAGGG + Intronic
920502832 1:206496316-206496338 GGAAGCAGCACAGCTGAGACTGG + Exonic
1062934297 10:1374683-1374705 GCAAACGGCCCAGCAGAGGACGG - Intronic
1065218356 10:23472162-23472184 GGAAAATTCTCAGCAGAGAGGGG - Intergenic
1065227249 10:23556728-23556750 GGAAGGTGCCCAGCACAGTCAGG + Intergenic
1067448738 10:46368564-46368586 GCAAACTGCTCTGCAGAGCCAGG + Intergenic
1067588632 10:47492201-47492223 GCAAACTGCTCTGCAGAGCCAGG - Intergenic
1067635760 10:48000292-48000314 GCAAACTGCTCTGCAGAGCCAGG - Intergenic
1067877736 10:50020029-50020051 GCAAACTGCTCTGCAGAGCCAGG + Intergenic
1069551487 10:69367396-69367418 GGGAACTGCCCAGCAGGAAATGG + Intronic
1069604067 10:69728993-69729015 GGAAACTGCCCACCCCAGATGGG - Intergenic
1069654505 10:70077820-70077842 GAAAACCTCCCAGCTGAGACAGG + Intronic
1069745817 10:70714344-70714366 AGAAACTGGCGTGCAGAGACAGG + Intronic
1069756545 10:70777277-70777299 GCAAAGTACTCAGCAGAGACTGG - Exonic
1070132319 10:73664299-73664321 GCAAACTGCTCTGCAGAGCCAGG - Intergenic
1074974163 10:118566852-118566874 GCAGACTGGCCAGCAGAGCCAGG - Intergenic
1075705109 10:124495773-124495795 AGAAGCTGCCCAGATGAGACAGG - Intronic
1076144352 10:128105335-128105357 GGAAACTGCAAAACAGAAACTGG - Exonic
1076144609 10:128107513-128107535 GGAAACTGCAAAACAGAAACTGG - Exonic
1076707253 10:132308501-132308523 GGAATCTGCCGGGCAGAGCCCGG + Intronic
1077005456 11:353427-353449 GGAACCTGCCGGGCAGACACAGG - Intergenic
1077200959 11:1307300-1307322 GGAAACAGCCCAGGAGGCACTGG + Intronic
1078062801 11:8059360-8059382 AGAAATTGCCCAGCTGAGGCAGG + Intronic
1079175636 11:18137646-18137668 GGATACTCCGCAGCAGGGACAGG - Exonic
1079268220 11:18956546-18956568 GGACGCTCCGCAGCAGAGACAGG + Intergenic
1079695568 11:23478031-23478053 GGAAACTGCCCTGAGGAGGCTGG + Intergenic
1080685172 11:34509446-34509468 AGAGACTTCCCAGCAGAGTCTGG - Intronic
1081399403 11:42625445-42625467 AGAAGCTGCTTAGCAGAGACAGG - Intergenic
1081967908 11:47180523-47180545 GGAAGCCGCCCAGCACAGGCCGG + Exonic
1082775804 11:57243629-57243651 GGAAACTGCCCCACAGAGAGGGG - Intergenic
1083456462 11:62782211-62782233 GGACACTGCCCACCAGACAGCGG - Exonic
1085621031 11:78038145-78038167 GAAAATTGGCCAGCAAAGACAGG + Intronic
1085698709 11:78727768-78727790 GGAAAGGAACCAGCAGAGACAGG + Intronic
1086066212 11:82747942-82747964 GCAAACTGCCCATCAGACAAGGG + Intergenic
1087706833 11:101502893-101502915 AGAAGCTGCCCAGGAAAGACTGG + Intronic
1088731708 11:112689615-112689637 GGAGACTGCCCAGGTGAGCCTGG - Intergenic
1088914571 11:114217789-114217811 GGGCACTGCTCAGCAGAGAAGGG + Intronic
1089389039 11:118087460-118087482 GGGAACTGCCCTTCAGAGATGGG - Intronic
1089960890 11:122616533-122616555 AGACACTTCCCAGCAGAGCCTGG - Intergenic
1089986269 11:122816932-122816954 GGAATCTGTCAAGCAGAGAATGG - Intergenic
1091400028 12:175935-175957 GGAATGTGCCCAGCAGAGATGGG + Exonic
1091459225 12:631249-631271 AGAGACTGCCCAGCAGAGGCGGG - Intronic
1091831577 12:3554151-3554173 CAAAACAGCCCAGCAGTGACAGG - Intronic
1096121185 12:49090378-49090400 GGGAACTGCACCGCGGAGACTGG - Exonic
1096799987 12:54104061-54104083 AGAAACTTCCCAGCAGAAAAAGG + Intergenic
1096982555 12:55736835-55736857 GGAAGCTGCCTAGCACAGGCTGG + Intergenic
1097822477 12:64142189-64142211 GTAAACGGCCCAGCAGAGTATGG - Intronic
1100290136 12:93205793-93205815 GGAAACTTCATAGCAGAGCCTGG - Intergenic
1100603093 12:96129083-96129105 TGAAGCTGCACAGCACAGACAGG - Intergenic
1101323912 12:103698027-103698049 GGAAACTGCCAACCAGATTCAGG + Intronic
1101453293 12:104801859-104801881 GGAAATCTCCCAGAAGAGACTGG - Intergenic
1101466976 12:104958523-104958545 GGAGCCTGCCCAGGAGAGAAGGG + Intronic
1101986861 12:109453894-109453916 AGATACTGCCCAGGACAGACGGG + Intronic
1102134706 12:110563844-110563866 GGCAACTGCCCAGAATAGTCTGG - Intronic
1103716533 12:122948591-122948613 GCACAGTCCCCAGCAGAGACAGG + Intronic
1104661489 12:130614026-130614048 TAACACTGCCCTGCAGAGACGGG - Intronic
1105025741 12:132847708-132847730 GGCAAATGGCCAGAAGAGACAGG + Intronic
1108091474 13:46854216-46854238 GAAAAGTGCCCAGCAGTGATGGG + Intronic
1108772703 13:53724196-53724218 GGGAAGTGCCCAGCAGTCACAGG - Intergenic
1113219675 13:108085361-108085383 GGAAAGTTCTCAGCAAAGACAGG - Intergenic
1118346646 14:64946008-64946030 GTAAACAGGCCAGCAGAGCCTGG + Exonic
1118468894 14:66056754-66056776 GAGAGCAGCCCAGCAGAGACCGG + Intergenic
1119761417 14:77154679-77154701 GGCAGCTGCACAGCAGGGACAGG + Intronic
1122138392 14:99647506-99647528 GGAAACTTCCCAGGACAGCCTGG + Intronic
1122573902 14:102728657-102728679 GCAAACTGACCAGCAGTGCCAGG + Exonic
1123467601 15:20528288-20528310 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1123650513 15:22472754-22472776 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123740921 15:23281596-23281618 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1123746077 15:23320962-23320984 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124278346 15:28344279-28344301 GGAAACTGCCCCGCTGAGGCTGG - Intergenic
1124304356 15:28567329-28567351 GGAAACTGCCCCGCTGAGGCTGG + Intergenic
1124533229 15:30523795-30523817 GGAGACTGCCCCGCTGAGGCTGG + Intergenic
1124765428 15:32483849-32483871 GGAGACTGCCCCGCTGAGGCTGG - Intergenic
1125187209 15:36944780-36944802 GGAAATTGCTGAGCAGAGAGAGG + Intronic
1125931605 15:43604229-43604251 GGAGACTGCAAAACAGAGACAGG - Intronic
1125944709 15:43703709-43703731 GGATACTGCGAAACAGAGACAGG - Intergenic
1126881080 15:53098758-53098780 GGAACCTGACCAACAAAGACAGG + Intergenic
1127773288 15:62247130-62247152 GGAAAGGGCCCTGCAGAGAGGGG + Intergenic
1127774603 15:62255142-62255164 GGAAAGGGCCCTGCAGAGAGGGG + Intergenic
1128033136 15:64499545-64499567 GGAAAAGGACCAGCAGAAACTGG + Exonic
1129413491 15:75362251-75362273 GGAAACTCACCAGCAAAGCCGGG + Intronic
1129826571 15:78638530-78638552 GGAGACTGCCCCACAGAGCCTGG + Intronic
1130484546 15:84391411-84391433 GGAAAGGGCCCTGCAGAGAGGGG - Intergenic
1131536866 15:93245054-93245076 GAAAAGTGCCCAGCATACACTGG - Intergenic
1132055154 15:98647092-98647114 GGAAACAGCCCAGCAGTGGCAGG - Intergenic
1133667107 16:7979397-7979419 GGTAACGGCCCAGCAGAGATGGG + Intergenic
1134039666 16:11058881-11058903 GGAAACGGCCCATCACAGCCAGG - Intronic
1134557628 16:15179357-15179379 AGAAACTGGCCACCAGTGACAGG + Intergenic
1134604234 16:15557672-15557694 GGAAACTGCAGTGCAGAAACTGG + Intronic
1134918195 16:18091040-18091062 AGAAACTGGCCACCAGTGACAGG + Intergenic
1136277402 16:29187081-29187103 GGACAGTGCCCAGCACAGGCTGG + Intergenic
1137634298 16:49972494-49972516 GGAAACTCACCAGCAGAAAAGGG + Intergenic
1138008294 16:53356997-53357019 GGAAACTGCCCTGCTGAGTCTGG - Intergenic
1138541862 16:57692961-57692983 GGGAACTCCCCAGCAGACATTGG - Intergenic
1138714718 16:59008068-59008090 GGAAACTGTGCATCAGAGACAGG + Intergenic
1138955067 16:61961566-61961588 GGAAACAGGAGAGCAGAGACTGG - Intronic
1139599544 16:67978319-67978341 AGAAACTGCGCAGCACAGAGAGG + Exonic
1139793729 16:69464115-69464137 GGAAACTGCCCAGCAAACCAGGG + Exonic
1141421728 16:83922049-83922071 GGAAAGTGCCCAGCAGTGTTGGG + Exonic
1141493446 16:84390432-84390454 GGAAACGGCCTAGAAGAGAAAGG - Intronic
1142081779 16:88153124-88153146 GGACAGTGCCCAGCACAGGCTGG + Intergenic
1142560071 17:804574-804596 GGTAACTGCCCAGCCGGGCCAGG - Intronic
1142766434 17:2067072-2067094 GGAGCCTGCCCAGCTGAGGCAGG + Intronic
1143392768 17:6569805-6569827 GGAAACTGCACAGAAGGGGCTGG + Intergenic
1144216849 17:13063479-13063501 GGAAACTGACCCTCAGAGATTGG - Intergenic
1145103479 17:20095956-20095978 CGAGACTGGCCAGCAGGGACCGG - Intronic
1145267337 17:21386162-21386184 GGAACCAGCCCTGCAGACACCGG - Intronic
1147471501 17:40666381-40666403 TGAGAATGCCCAGCATAGACTGG - Intergenic
1148969539 17:51467795-51467817 AGAAACTGGCCAGAAGAGCCTGG + Intergenic
1149470299 17:56910830-56910852 GGGCATTGCCCAGCTGAGACTGG + Intronic
1158438446 18:57451726-57451748 GGAAAATTCACAGCAGAGACAGG + Intronic
1158543487 18:58377066-58377088 GGAAGCTGAGCAGGAGAGACAGG - Intronic
1160243663 18:77140481-77140503 GAAAACAGCTCAGCAGACACAGG - Intergenic
1160503257 18:79412583-79412605 TGAGACTGCAGAGCAGAGACGGG - Intronic
1161678150 19:5664732-5664754 AGACACTTCCCAGCAGAGCCAGG - Intronic
1162070916 19:8151611-8151633 GGAGGTGGCCCAGCAGAGACAGG + Intronic
1163130069 19:15266823-15266845 GGAAACTCTCCAGCAGCTACTGG - Intronic
1163368740 19:16890204-16890226 GGAAACAGCCCAACAGCGCCAGG - Exonic
1164465285 19:28482476-28482498 GGAAAGCTCCCAGCAAAGACAGG - Intergenic
1164793251 19:31005631-31005653 GGAACCTGCACACCAAAGACAGG - Intergenic
1165318544 19:35072403-35072425 CGAACCTGCTCAGCAGAGAGAGG - Intergenic
1167296698 19:48654656-48654678 GGAATTTGCCCAGCAGAGAAGGG - Intergenic
925146680 2:1587223-1587245 GGAACCTGCACAGTGGAGACCGG + Intergenic
925322968 2:2991058-2991080 GGAAATTGCACAGCAGGGCCAGG + Intergenic
926097991 2:10094965-10094987 GCAGACTTCCCAGCAGAGGCAGG + Intergenic
927485308 2:23484802-23484824 AGCAAGAGCCCAGCAGAGACTGG - Intronic
927958727 2:27226086-27226108 GGTCACTGCCAAGCAGAGTCAGG - Intronic
928080706 2:28309936-28309958 GGAAAAGGCCCAGGAGGGACGGG - Intronic
931010399 2:57905624-57905646 GGATATTGCCCAGCACAGACTGG - Intergenic
931756826 2:65382073-65382095 AGAAACCACCCAGCAAAGACTGG - Intronic
931766948 2:65465381-65465403 GATAACTGCACAGCAGAGCCTGG - Intergenic
932335541 2:70929015-70929037 GGAAGCTTCCCAGCAGGGAGGGG + Intronic
932848552 2:75159619-75159641 GGAGTCTTCCCAGCAGAGAAAGG + Intronic
933716334 2:85363825-85363847 GAGAACAGCACAGCAGAGACTGG + Intronic
933851067 2:86367117-86367139 GGAAACTGCTGACAAGAGACAGG + Intergenic
935058758 2:99590311-99590333 AGAACCTGCCCTGCAGAAACAGG + Intronic
936531023 2:113277311-113277333 GGAGACTGCGCCGCAGAGCCCGG + Intronic
937245065 2:120487168-120487190 GGAAATTGCACAGCAGTGCCGGG + Intergenic
938701499 2:133884175-133884197 TGAATCTCTCCAGCAGAGACAGG + Intergenic
942553247 2:177143683-177143705 GGAAACTGGCAATGAGAGACTGG - Intergenic
945090720 2:206173205-206173227 GGAAACTGCACAGCATGGAATGG - Intergenic
947020085 2:225665221-225665243 GGAACCTGCTCAGCAAAGCCAGG - Intergenic
948303521 2:236928592-236928614 GTAAACAGACCAGCGGAGACTGG + Intergenic
948726830 2:239939254-239939276 GGAAAGTGTCCAGAAGACACTGG - Intronic
1169029695 20:2397810-2397832 GCAAACTGCCCTGCACAGATGGG + Intronic
1171796462 20:29570281-29570303 AGAAACTTCCCAGCAGAAAAAGG - Intergenic
1171851781 20:30313888-30313910 AGAAACTTCCCAGCAGAAAAAGG + Intergenic
1173313828 20:41925439-41925461 GGAAACTGCCCAGAGAAGCCGGG - Intergenic
1175141056 20:56860348-56860370 GGAGGCTGCCCAGAGGAGACTGG + Intergenic
1176115576 20:63430552-63430574 TGACACTGCCCTGCAGAGCCTGG - Intronic
1176206231 20:63889723-63889745 GAACACTGCTCAGCAGGGACAGG - Intronic
1177422678 21:20881656-20881678 GTAAAATGCACAGCAGACACAGG - Intergenic
1178407372 21:32335705-32335727 GCAGACTGCCCATCACAGACCGG + Intronic
1178560799 21:33637882-33637904 GGATACTGCCCAAGAGAGCCTGG - Intronic
1179548115 21:42125670-42125692 GGAAACTGCCGAGAAGCCACAGG - Intronic
1182502367 22:30756759-30756781 ACAAACTGCCCAGCAGTCACTGG + Intronic
1182549180 22:31091766-31091788 TGACACTGCCCAGCCGAGCCAGG - Exonic
1182665519 22:31956351-31956373 GGAACTTGTCAAGCAGAGACAGG - Exonic
1183052300 22:35273208-35273230 GGAAAATGCCTAGGAGAGCCTGG - Intronic
1183256251 22:36764273-36764295 CGGAAGTGCCCAGCAGAGCCTGG - Intronic
949498616 3:4656915-4656937 GGAGTCTGCTCAGAAGAGACTGG - Intronic
949936460 3:9119795-9119817 GGAGACAGCCCAGCAGGGCCCGG + Intronic
950166569 3:10805163-10805185 GGACACTGCCCAGCAAATAGTGG - Intergenic
952981490 3:38739520-38739542 GGAAGCTCCGCAGCACAGACAGG + Exonic
953143103 3:40247836-40247858 GGAAACCACACAGCACAGACTGG - Intronic
954616328 3:51970509-51970531 GGAAACTGAGCAGCTGAGAGAGG - Intronic
954676781 3:52320318-52320340 GGCAGCTGGCCACCAGAGACTGG + Intronic
955871001 3:63438077-63438099 GCAAAGTGCCCAGCACAGAGCGG - Intronic
956802086 3:72768942-72768964 GCAAAATGCCCAGCAAATACTGG - Intronic
960539594 3:118848717-118848739 GGAAACTGCCGAGCAGATGCTGG + Intergenic
961504058 3:127358552-127358574 GGAGACAGCTCAGCAGAGAAAGG - Intergenic
962988783 3:140559890-140559912 GGAAACTGCCCTGCCTGGACAGG - Intronic
968170735 3:196507985-196508007 GCAAACTGTCCTGCAGAGCCTGG + Exonic
968757928 4:2426385-2426407 GGACCCTCCCCAGCAGCGACAGG - Intronic
969270107 4:6093941-6093963 GGGGACTGCCCAGCCGAGCCAGG - Intronic
970068113 4:12122592-12122614 GGAAATTGCCCAGGAGAGTCTGG + Intergenic
970520619 4:16880284-16880306 GGAAACTGCCCAACAGGAAATGG - Intronic
973534384 4:51866905-51866927 GGAAGGAGCCCAGCAGACACAGG - Intronic
974576337 4:63728620-63728642 AGAAACAACCCAGCAGACACAGG - Intergenic
974715613 4:65667320-65667342 GAAAACTGCTCAGCTGAGATAGG + Intronic
976862868 4:89687630-89687652 GTAGCCTGCCCAGCAGGGACTGG - Intergenic
977943607 4:102884450-102884472 GAAAAGAGCCCAGCAGAGGCAGG + Intronic
981366331 4:143907851-143907873 GGAAACAGAACAACAGAGACAGG - Intergenic
981376437 4:144021628-144021650 GGAAACAGAACAACAGAGACAGG - Intergenic
981386950 4:144142972-144142994 GGAAACAGAACAACAGAGACAGG - Intergenic
983518112 4:168678310-168678332 GTAAAGTGCCCAGCAGACGCCGG + Intronic
985387535 4:189463142-189463164 TGAAAGTGGCCAGCAGAGCCAGG - Intergenic
985972801 5:3391528-3391550 GGAAGCAGCCCGGCAGAGTCAGG - Intergenic
986994510 5:13591838-13591860 GAAAACTGCCCAGTAGAAAGAGG - Intergenic
988334248 5:29885269-29885291 GGGAAGTGCCCAGCAGTCACAGG - Intergenic
988515229 5:31898705-31898727 GGAAACTGCCCCCCAGAGCTAGG - Intronic
988564005 5:32306015-32306037 GGTAACTGCTGAGCAGATACAGG - Intronic
988849282 5:35162778-35162800 GGAAACTGCCCGGGAGACACAGG - Intronic
989429623 5:41337384-41337406 CCAAACTGCCCAGCAGAAGCTGG + Intronic
994944687 5:106371268-106371290 GAAAAATGGCCTGCAGAGACTGG + Intergenic
996492537 5:124115010-124115032 GGAAAATGCCCAGCATAGAGTGG + Intergenic
996529199 5:124509977-124509999 GAAAAGTGCCCAGCTGAGCCTGG - Intergenic
996642330 5:125770891-125770913 GGAAATAGGGCAGCAGAGACAGG + Intergenic
999191014 5:149747642-149747664 GGTACCTGCCCAGCAGCGCCTGG + Intronic
1000382078 5:160638272-160638294 GGAATCTGCCAAGCAGATTCTGG + Intronic
1002698919 5:181108978-181109000 GGACACTGTCCCGCAGAGGCAGG - Intergenic
1002901206 6:1410995-1411017 GGAACTTGCCCAGAAGAGATAGG + Intergenic
1002988614 6:2216841-2216863 GGCACCTGCCCAGGAGAGGCGGG - Intronic
1003310913 6:4969273-4969295 GCAAACTGCCAAGCGGAGAAAGG + Intergenic
1006927649 6:37666496-37666518 GGAAACGTCCCATCAGTGACAGG + Intronic
1016046040 6:139481533-139481555 GGTAACACCCCAGCAGAGGCTGG + Intergenic
1017804174 6:157928875-157928897 GAAAACTGACCAGCAAAGCCAGG + Intronic
1018367473 6:163136242-163136264 GGAAACTTCACATCAGAGAGAGG - Intronic
1020003402 7:4768497-4768519 CGGAAAAGCCCAGCAGAGACAGG - Exonic
1020253980 7:6491492-6491514 GGCAGGTGCCCAGCATAGACAGG + Intergenic
1021807743 7:24373853-24373875 GGAAACTGGCCAGCAGTGACAGG - Intergenic
1023402897 7:39803194-39803216 CGAGGCTGCACAGCAGAGACAGG + Intergenic
1023613307 7:41993251-41993273 GGAAAATGCCCTCCAGAGGCTGG + Intronic
1024402927 7:48945989-48946011 GGAAAGTGCAGAGCAGAGATGGG + Intergenic
1024646735 7:51377442-51377464 CGAGGCTGCACAGCAGAGACAGG - Intergenic
1026141581 7:67711488-67711510 GAACACTTCCCAGCAGAAACAGG - Intergenic
1026947905 7:74327994-74328016 GAAGAATGCCCAGCAGAGCCTGG + Intronic
1032069489 7:128795022-128795044 GGAAAGAGCCCACCAGGGACAGG - Intronic
1033757602 7:144407751-144407773 GGAAACTGCCGGGCAGGGCCAGG + Intronic
1034547783 7:151800386-151800408 GGAAACTGACGACCAGAGATGGG - Intronic
1035109070 7:156465232-156465254 GGGTCATGCCCAGCAGAGACGGG - Intergenic
1035160030 7:156943596-156943618 GGGAACTCCCCAGCACAGCCTGG + Intergenic
1035369002 7:158366949-158366971 CGGCACTGCCCAGCACAGACAGG - Intronic
1035679482 8:1477431-1477453 TGAATCGGCCCAGCAGGGACAGG - Intergenic
1038021383 8:23554368-23554390 GGAAGCTGGGCAGGAGAGACTGG + Intronic
1038677257 8:29634638-29634660 AGAAACATCGCAGCAGAGACAGG + Intergenic
1039496308 8:37983238-37983260 TGAAACTGACCAGAACAGACAGG + Intergenic
1039711489 8:40060207-40060229 GGAAACAGAGCAGCAGAGAATGG + Intergenic
1039746202 8:40430415-40430437 GGAAACTGACTACCAGAGAGGGG + Intergenic
1039840535 8:41289984-41290006 GGCAGCTGCCCAGCACAGCCAGG + Intronic
1040786882 8:51176787-51176809 GGAAATTTCTCAGCAGAGAGGGG + Intergenic
1041063203 8:54056532-54056554 GGAAACTACCCATCTGAGAAGGG + Intronic
1042381593 8:68120993-68121015 GGAATCTTCCCAGCAGCGTCCGG + Exonic
1044333250 8:90945667-90945689 GGAAACTGCCCATAATGGACGGG - Intronic
1044560367 8:93606493-93606515 GGTATCTTCCCAACAGAGACAGG + Intergenic
1048221007 8:132541974-132541996 GGAAATTGCCAAGAAGAGAGGGG - Intergenic
1049248803 8:141577286-141577308 GGACACTTCACAGCAGAGGCTGG - Intergenic
1049387949 8:142353754-142353776 GGAACCACCCCAGCAGAGAAGGG + Intronic
1049604734 8:143524057-143524079 GGAGGCTGCCCGGGAGAGACGGG - Intronic
1053789563 9:41677141-41677163 AGAAACTTCCCAGCAGAAAAAGG + Intergenic
1054155580 9:61637611-61637633 AGAAACTTCCCAGCAGAAAAAGG - Intergenic
1054177901 9:61888832-61888854 AGAAACTTCCCAGCAGAAAAAGG + Intergenic
1054475349 9:65568621-65568643 AGAAACTTCCCAGCAGAAAAAGG - Intergenic
1054659628 9:67691992-67692014 AGAAACTTCCCAGCAGAAAAAGG - Intergenic
1055257757 9:74392624-74392646 GGGAAATCCACAGCAGAGACTGG + Intergenic
1055816148 9:80209483-80209505 GGAAACAGTGCAGCAGAGGCAGG - Intergenic
1056579569 9:87880971-87880993 GCACACAGCCCACCAGAGACTGG + Intergenic
1057268646 9:93634886-93634908 AGAAAAGGCCCAGCAGAGTCTGG + Intronic
1058901864 9:109449131-109449153 GGAAACAGCCCACCAAAGATGGG + Intronic
1059226647 9:112679112-112679134 GGAGACTGCCCACCACAGAGTGG + Intergenic
1059887956 9:118768040-118768062 GGAAACTGAGGAGCAGAGAAGGG + Intergenic
1060402227 9:123355755-123355777 TGCAGCTTCCCAGCAGAGACAGG + Intergenic
1061613803 9:131766005-131766027 GGATCCCGCCAAGCAGAGACAGG - Intergenic
1062219011 9:135404338-135404360 GGACACTGCCCAGCAGCCTCTGG + Intergenic
1187121021 X:16406466-16406488 AGAAACTGTCCAGTAGAAACAGG - Intergenic
1187618504 X:21025345-21025367 GGAAACAGGCCAACAGAGAGGGG - Intergenic
1187948275 X:24447557-24447579 GGAAATTGCCTAGAAGAGAGGGG + Intergenic
1189056210 X:37701845-37701867 GGAGAGTGCCCAGCAGAGGAAGG + Intronic
1189987045 X:46562684-46562706 GGAATCTGCAAAGCAGACACTGG - Intergenic
1190902891 X:54695961-54695983 TGAAACTGCCCAGCTGAGAGAGG + Intergenic
1192510330 X:71717377-71717399 GGAAACGGCCCGGCACAGGCAGG + Exonic
1192516367 X:71764176-71764198 GGAAACGGCCCGGCACAGGCAGG - Exonic
1195905479 X:109840287-109840309 GGAAGCTGCCCACCTGAGAGGGG + Intergenic
1198675539 X:139126744-139126766 TGAAACTGCCCAGCAGGAGCAGG - Intronic
1199125729 X:144117311-144117333 AGAAACTGCCCAGCAGTCAGAGG - Intergenic
1200788716 Y:7281091-7281113 GGAAAGTCCCAGGCAGAGACAGG + Intergenic
1201295160 Y:12455979-12456001 CGGAACAGCCCAGCACAGACAGG + Intergenic
1201857952 Y:18566225-18566247 GGAAACTGCCCAGCAGAGACAGG + Intronic
1201860008 Y:18586433-18586455 GGAAAGTGCCAAGGAGAGATAGG + Intronic
1201873313 Y:18733948-18733970 GGAAAGTGCCAAGGAGAGATAGG - Intronic
1201875369 Y:18754156-18754178 GGAAACTGCCCAGCAGAGACAGG - Intronic
1201992707 Y:20044830-20044852 AGAAACTGACCAGCACAGAATGG - Intergenic
1202167095 Y:22001210-22001232 GGAAAGTGCCCAGCAGACAGAGG - Intergenic
1202169082 Y:22021837-22021859 GGAAACTGCCCAGCAGAGACAGG - Intergenic
1202222279 Y:22564531-22564553 GGAAACTGCCCAGCAGAGACAGG + Intergenic
1202224265 Y:22585163-22585185 GGAAAGTGCCCAGCAGACAGAGG + Intergenic
1202318849 Y:23610497-23610519 GGAAAGTGCCCAGCAGACAGAGG - Intergenic
1202320836 Y:23631130-23631152 GGAAACTGCCCAGCAGAGACAGG - Intergenic
1202549931 Y:26038926-26038948 GGAAACTGCCCAGCAGAGACAGG + Intergenic
1202551920 Y:26059560-26059582 GGAAAGTGCCCAGCAGACAGAGG + Intergenic