ID: 1201877205

View in Genome Browser
Species Human (GRCh38)
Location Y:18775279-18775301
Sequence ACATGGGTGTGGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 577
Summary {0: 2, 1: 0, 2: 2, 3: 61, 4: 512}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201877205 Original CRISPR ACATGGGTGTGGAGGAAAGA GGG Intronic
900819845 1:4878259-4878281 ACACAGGTGTGGAGTGAAGAGGG + Intergenic
900888328 1:5430997-5431019 ACATGCGGGGAGAGGAAAGAAGG - Intergenic
900902519 1:5526713-5526735 GCATGGGTGCGGTGGACAGACGG + Intergenic
901272434 1:7963058-7963080 AAATGGGTCTGAAGGAAATATGG - Intronic
901316793 1:8315130-8315152 TCCTGGGTGTGGGGGAAGGATGG - Intergenic
901447738 1:9318475-9318497 ACCTGGGAGTGGAGGAAGGAGGG - Intronic
903005319 1:20294377-20294399 ACATGGGGGTTGGGGAAAAAGGG + Intronic
903632452 1:24786430-24786452 ACAGGGGTGTGAAGGGAAGAGGG + Intronic
903657222 1:24956799-24956821 AAAGGGGTGGGGAGGAAAGGAGG - Intronic
904957660 1:34298656-34298678 AGATGGATGTGGGGGAAGGAAGG - Intergenic
905243596 1:36597001-36597023 TCATGGGTGATGAGGAAACAGGG - Intergenic
905246213 1:36615883-36615905 ACATGGTGGTAGATGAAAGATGG + Intergenic
905345313 1:37307252-37307274 AAATTGGGGAGGAGGAAAGAAGG + Intergenic
905583457 1:39099591-39099613 TCATGTGTAGGGAGGAAAGAGGG - Intronic
906025275 1:42668312-42668334 AAATGGGTGAGGAGGCAAGAAGG - Intronic
906148456 1:43573707-43573729 AGATGGGTGTGGGGGACTGAAGG - Intronic
906468703 1:46108743-46108765 TGGTGGGTGTGGAGGCAAGAAGG - Intronic
907674448 1:56505955-56505977 ACATGGATGTGGGAGAGAGAAGG - Intronic
907721115 1:56973224-56973246 AAATGTGTGGGGAGGAAAAATGG + Intergenic
907933968 1:59025605-59025627 ACGTGGATGTGAAGGAAATATGG - Intergenic
909871126 1:80740469-80740491 ACATGGATGTGGATAAAAAAAGG + Intergenic
910368286 1:86489234-86489256 ACTGGGGAGTGGGGGAAAGATGG + Intronic
910450049 1:87335223-87335245 AGGTGGGGGTGGAGGAAAGACGG - Intronic
912075717 1:105873132-105873154 GCCTGGGTGTGGAGCAAAGAAGG + Intergenic
912447600 1:109749818-109749840 ACATGTGTGTGCAAAAAAGATGG + Intronic
912891760 1:113540594-113540616 AATTGGGTGTGGAGGTTAGAAGG + Intronic
913206981 1:116547932-116547954 GCATGGGTGTGGTGGGAAAAGGG - Intronic
913646930 1:120866066-120866088 ACATGAGTGTTCAGGAATGATGG + Intergenic
914079717 1:144396798-144396820 ACATGAGTGTTCAGGAATGATGG - Intergenic
914174619 1:145265335-145265357 ACATGAGTGTTCAGGAATGATGG - Intergenic
914529346 1:148506823-148506845 ACATGAGTGTTCAGGAATGATGG - Intergenic
914848074 1:151293723-151293745 ACAGGGGTGGGGAGGTGAGAAGG + Intronic
914953431 1:152139822-152139844 ATATGAGTGAGGAGGAAAAATGG - Intergenic
915604475 1:156941902-156941924 ACCTGGGGGTGGAGGATGGACGG + Exonic
915705469 1:157839405-157839427 AAATGGCTGGGGAAGAAAGAAGG + Exonic
915723536 1:158001646-158001668 ACATGGATGTGGCAGGAAGAGGG + Intronic
916243823 1:162666567-162666589 AAATGTGTGTGGGGGAAAGGGGG + Intronic
916677039 1:167072852-167072874 GCCTGGGGGTGGAGGAAAGTGGG + Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
917611032 1:176689202-176689224 CCATGGGAGAGGAGGAAAGCAGG + Intronic
918189238 1:182156208-182156230 ACAAGGGTGTGGAGCAAGGAAGG + Intergenic
918497361 1:185156342-185156364 AAAATGGTGGGGAGGAAAGAGGG - Intronic
918927862 1:190810559-190810581 ACAGGCATTTGGAGGAAAGAAGG - Intergenic
919103793 1:193124386-193124408 ACATTGGTTTAGAGGAAAAATGG + Intronic
919689534 1:200516894-200516916 AGATGGCTGGGGAGGGAAGAAGG + Intergenic
919724429 1:200872891-200872913 AAATGGGTGGGCAGGAAAGAGGG - Intergenic
920753234 1:208702691-208702713 ACCTGGGTGTGGAGCCAAGATGG + Intergenic
921440644 1:215182201-215182223 GCCTGGGTGTGGAGCAGAGAGGG + Intronic
922068853 1:222170839-222170861 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
923749490 1:236734414-236734436 AAATCTGTGTGGAGAAAAGAAGG - Exonic
923830015 1:237545053-237545075 ACAAGGTTATAGAGGAAAGAAGG + Intronic
924297684 1:242604781-242604803 AAATGGGGGTGGATGGAAGAGGG + Intergenic
1063775306 10:9256614-9256636 AAATTGGTGGGGAGGAGAGAAGG + Intergenic
1064311580 10:14216815-14216837 ACATGGCTGTGTAGGCAAGGAGG + Intronic
1065706304 10:28474411-28474433 GCATGGGTGAGAAAGAAAGACGG + Intergenic
1065706924 10:28479038-28479060 AGAAGGGTGGGGAGGAAAGTGGG + Intergenic
1065752829 10:28903429-28903451 ACCTGTGTGGGGAGGAGAGAAGG + Intergenic
1066156640 10:32684809-32684831 ACAAGTGTGTGGAGAAGAGACGG - Intronic
1066288635 10:33993143-33993165 CCAAGGGTGTGGAAGAGAGAAGG + Intergenic
1066415044 10:35213957-35213979 GCTTGGGTCTGGAGGACAGAGGG + Intergenic
1066535745 10:36389614-36389636 TCATGGGTGTGGTGGAAACATGG + Intergenic
1066643462 10:37580343-37580365 TCATGGGTGCGGTGGAAACATGG + Intergenic
1067106983 10:43373125-43373147 GCAAGGGTGTGGAGGAGGGAGGG - Intronic
1067673261 10:48346080-48346102 ACTTGGGGGTGAAGGGAAGACGG - Intronic
1067879766 10:50033147-50033169 TCATGGCTGTGCAGGAATGAGGG - Intergenic
1068415335 10:56713204-56713226 ACAGGGATGTGGAAGAAAGGAGG + Intergenic
1068433609 10:56963324-56963346 ACTTGGGTGTGAAGCAGAGAGGG - Intergenic
1071882056 10:89910440-89910462 GCAGAGGTTTGGAGGAAAGAAGG + Intergenic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1072743215 10:97922663-97922685 AACTGGATGGGGAGGAAAGACGG - Intronic
1073044920 10:100631442-100631464 ACTTAGCTGTTGAGGAAAGAGGG + Intergenic
1074007068 10:109437556-109437578 ACTAGGGAGTGAAGGAAAGAAGG + Intergenic
1074269688 10:111941734-111941756 CCATGGGTTTGGAGAAAAGCAGG - Intergenic
1074491588 10:113943903-113943925 ACATGGGTGTCATGGAAATATGG + Intergenic
1076652814 10:132001589-132001611 ACTTGGGTGTGGAGAGATGAGGG - Intergenic
1077195625 11:1278648-1278670 GTGTGGGTGTGGAGGAAAGGTGG - Intronic
1077941091 11:6844321-6844343 ACCTGTTTCTGGAGGAAAGAAGG - Intergenic
1079258395 11:18852867-18852889 ACCTGGGCATGGAGCAAAGAGGG - Intergenic
1079322559 11:19463755-19463777 ACAAGGTTTTGGAGGCAAGAGGG + Intronic
1079362457 11:19780354-19780376 ACTAGGGTGTGGAGGGAAGGTGG - Intronic
1079663769 11:23076844-23076866 ACTTGAGGGTGGAGGATAGAAGG + Intergenic
1079969323 11:27017180-27017202 ACATGGGTCAGGAGGCAGGAAGG - Intergenic
1080282643 11:30576123-30576145 AAAAGGCTGTGGAGGATAGAAGG - Intronic
1080831078 11:35893946-35893968 AGCTGGGTGTTGAGGAAAGAAGG - Intergenic
1081443065 11:43101133-43101155 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1081596736 11:44464403-44464425 ACATGGGTGTGGAAGAGAGGAGG - Intergenic
1082134733 11:48534057-48534079 ACAGGGGGGTGGAGCCAAGATGG - Intergenic
1082801271 11:57416531-57416553 GCTTGGGTCTGGAGGAGAGATGG + Intronic
1083310327 11:61780564-61780586 ACATGGGGTAGGAGGAAGGAGGG + Intronic
1083366917 11:62146935-62146957 CCATGTGTGTGGAAGAGAGACGG + Intronic
1083393702 11:62373893-62373915 ACTTGGGGGTGGAGCAAAGGTGG + Intronic
1084535462 11:69753770-69753792 ACATGAGTGAGGTGGAATGAGGG - Intergenic
1085773491 11:79344991-79345013 ATATGAGTGGGGAAGAAAGATGG - Intronic
1085789239 11:79482503-79482525 ACCTGGGGGTGGAGGACAGAAGG + Intergenic
1085826286 11:79851269-79851291 ACATGCATGTGAAGGAAAGAAGG - Intergenic
1086976252 11:93136635-93136657 ACATGGGGGAGGAGCCAAGATGG + Intergenic
1086982342 11:93212355-93212377 AGCTGGGGGTGGAGGAAATAGGG + Intergenic
1087013321 11:93533428-93533450 ACATGGCAGTGCAGGGAAGAAGG + Intronic
1088470960 11:110187267-110187289 CCCTGAGTGTGGAGCAAAGAGGG - Intronic
1088714269 11:112535055-112535077 ACATGGGGGTGGAGGGGAGAGGG + Intergenic
1089200200 11:116720211-116720233 GCATGGAGGTGGAGGAAAGAAGG - Intergenic
1090416906 11:126546835-126546857 ACAAATGCGTGGAGGAAAGAGGG + Intronic
1090889542 11:130911252-130911274 ATCTGGGTGTTAAGGAAAGAAGG + Intronic
1091006498 11:131958571-131958593 AAATTGGGGTGGAGGAAGGACGG - Intronic
1091098031 11:132842188-132842210 ACATCGGTGTTGGGGAAGGAAGG - Intronic
1091415411 12:278608-278630 AGATGAGTGAGGAGGATAGATGG + Intergenic
1091612200 12:2020629-2020651 AAATGGTTGAGCAGGAAAGAAGG + Intronic
1092004452 12:5057366-5057388 AGATGGGTGTGGAGGGATGGAGG + Intergenic
1093134810 12:15437666-15437688 TCCTGGGTGTGGAGCAGAGAGGG - Intronic
1093809316 12:23472866-23472888 GCCTGGGTGTGGAGGAAAAAGGG - Intergenic
1093897653 12:24592923-24592945 GCATAGGTGGGGAGGAGAGAAGG + Intergenic
1094029046 12:25989789-25989811 GCATGGGGGTGGAGGAATTATGG + Intronic
1094741047 12:33289518-33289540 ACATGGAAGAGGATGAAAGAAGG + Intergenic
1095705158 12:45228977-45228999 ACTTGGGTCTGGAGGGGAGAAGG + Intronic
1095814536 12:46406985-46407007 AAGTGGGTGGGGAGGGAAGATGG - Intergenic
1096096948 12:48941724-48941746 ATTTTGGTGTGGAAGAAAGATGG - Intronic
1096549762 12:52364365-52364387 ACCTGGGTGTGGGAGAGAGAAGG + Exonic
1096798318 12:54092330-54092352 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1097059468 12:56271839-56271861 GCAGGAGTTTGGAGGAAAGATGG + Exonic
1098719831 12:73882304-73882326 AAAGAAGTGTGGAGGAAAGAGGG - Intergenic
1100029156 12:90164607-90164629 CCAAGGGTGTGGAGGACACAAGG - Intergenic
1100122852 12:91388846-91388868 ACAAGAGTGTGGAGGACAGTGGG + Intergenic
1100252224 12:92838829-92838851 ACTTTGGTGTGGAGGAGAAATGG - Intronic
1100362842 12:93894157-93894179 CCACTGGTGTAGAGGAAAGAGGG - Intronic
1101633798 12:106520764-106520786 GCAGGGGTGTGGATGAAGGATGG - Intronic
1102012871 12:109629566-109629588 AGATGGGGGTGGTGGCAAGATGG - Intergenic
1102076085 12:110061320-110061342 GAATGGGTGAGGGGGAAAGAGGG - Intronic
1102602326 12:114041002-114041024 ACATGGTAGAGGATGAAAGATGG + Intergenic
1102935544 12:116893546-116893568 GCATGGATGTGCTGGAAAGAGGG + Intergenic
1103751609 12:123167849-123167871 GCATAGGTGTGGAGAAAACAAGG - Intronic
1105482318 13:20789807-20789829 ACATGGGTGGAAAGGAAAGGAGG - Intronic
1106482129 13:30144478-30144500 AGATGGGTGTGGAGGTGATAAGG - Intergenic
1106506651 13:30376342-30376364 ACAAGGATGTGGAGGGAAGGGGG + Intergenic
1107023476 13:35775543-35775565 TAATGGGTGTGGGGGAAAAATGG + Intronic
1107456913 13:40563595-40563617 TCTTGGGTGTGGAGGAAGGTGGG - Intronic
1107462401 13:40616739-40616761 CAAGGGGTGTGGAGGGAAGAAGG + Intronic
1108624974 13:52218883-52218905 ACATGGGGGTTGGGGTAAGAAGG - Intergenic
1108661078 13:52587534-52587556 ACATGGGGGTTGGGGTAAGAAGG + Intergenic
1109323027 13:60833328-60833350 CCATGGGGGTGGAGCCAAGATGG - Intergenic
1109339664 13:61039765-61039787 ACAAGGGTAGGGAGTAAAGACGG - Intergenic
1110638280 13:77791334-77791356 GCCTGGGTTTGGAGTAAAGAGGG - Intergenic
1110763247 13:79253429-79253451 AGCTGTGTGTGGAGGAAAGAAGG - Intergenic
1111144018 13:84157236-84157258 ACCTGGGTGTGAAGCACAGAGGG + Intergenic
1111327985 13:86724156-86724178 AGATGGGGTTGGAGGAAACAGGG + Intergenic
1111993627 13:95140777-95140799 ATATGGATTTGGAGGAAAAAGGG - Intronic
1112089994 13:96072977-96072999 ACAAGGGTGTGGAGGTAAGAAGG - Intergenic
1112407556 13:99134664-99134686 ACATCAGTGTGTAGGAAAGACGG - Intergenic
1112441226 13:99426390-99426412 AGAAGGGAGTGGAGGAATGAGGG - Intergenic
1112694392 13:101931506-101931528 ACATGGTGGAGGAGGAGAGAGGG - Intronic
1113233091 13:108237340-108237362 TTATGAGTGTGGAGGAATGAGGG + Intergenic
1113502117 13:110784054-110784076 ACATGTGTGGGGAGCAAATATGG - Intergenic
1114050918 14:18919386-18919408 GCAAGGGGGAGGAGGAAAGAGGG - Intergenic
1114111641 14:19482536-19482558 GCAAGGGGGAGGAGGAAAGAGGG + Intergenic
1114553987 14:23551112-23551134 ACAGGGGTGTGGGAGGAAGAGGG - Intronic
1115326640 14:32146440-32146462 ATATGGATGTTGAGGAGAGAGGG + Intronic
1115750021 14:36479997-36480019 ATTTGGGGGTGAAGGAAAGAAGG - Intronic
1116157178 14:41220300-41220322 ACTTGAGGGTGGAGGATAGAAGG + Intergenic
1116621024 14:47203321-47203343 ACATGGGAGTTGATGACAGATGG + Intronic
1117115043 14:52502585-52502607 ACAGGGGGGTGGAGCCAAGATGG + Intronic
1117493865 14:56281424-56281446 ACATAGGTATGGAAGAGAGATGG + Intronic
1117947722 14:61047320-61047342 AAAGGGATGTGGAGGAAGGATGG + Intronic
1118863170 14:69681458-69681480 ACATGGATGTGGAGAAAAGGGGG + Intronic
1119143949 14:72293514-72293536 AAATGGATGGGGAGGAAGGAAGG - Intronic
1119411277 14:74432362-74432384 ACCAGGGTGTGGAGGAGAGATGG - Intergenic
1120154397 14:81076623-81076645 AAGTGGGTGATGAGGAAAGAAGG - Intronic
1120539654 14:85737063-85737085 AGATGGGTCTGTAGAAAAGAAGG + Intergenic
1121281813 14:92704509-92704531 AAATGGCTGTAGAGGAAAGCTGG + Intronic
1121915784 14:97835980-97836002 ACATGTGTGTGGCAGAAACATGG + Intergenic
1122433009 14:101667976-101667998 ACATGGGTGAGGGGGCAAAACGG + Intergenic
1122706505 14:103625260-103625282 AAGAGGGTGGGGAGGAAAGAGGG - Intronic
1122719469 14:103714262-103714284 CCTTGTGTGTGGAGGAAATAAGG - Intronic
1123100761 14:105797913-105797935 ACATGGGTGTGGAGGCCTGCAGG - Intergenic
1124463757 15:29917992-29918014 GCAGGGGTTTGGGGGAAAGAGGG - Intronic
1124492629 15:30167492-30167514 CCATGGCTGTGGAGGAATGGCGG + Intergenic
1124670311 15:31633254-31633276 ACAGGGGGGTGGAGCCAAGATGG - Intronic
1124750905 15:32370833-32370855 CCATGGCTGTGGAGGAATGGCGG - Intergenic
1125184841 15:36918640-36918662 CCATGGGTGTGCAGAAAAGGTGG + Intronic
1126188168 15:45850950-45850972 ACATGGCTGGGGACGAATGAGGG - Intergenic
1126688488 15:51268249-51268271 GGATGGGTGTGGAGGAAGGATGG - Intronic
1127318628 15:57820310-57820332 CCATGGGTGAGGAGGAGAGAGGG + Intergenic
1127319686 15:57831042-57831064 ACAAGGGTGTGGAAGGAAGCGGG + Intergenic
1127709638 15:61583536-61583558 ACTTGAGGGTGGAGGGAAGAAGG + Intergenic
1128153217 15:65376544-65376566 AAATGGGTGGGGAGAAAGGAGGG + Intronic
1128327989 15:66737565-66737587 AATGGGGTGAGGAGGAAAGACGG - Intronic
1129156162 15:73719493-73719515 ACATGGTGCTGGAGGGAAGAGGG - Intergenic
1129692680 15:77722753-77722775 GCGTGGGTGTAGAGGAAAGAGGG + Intronic
1130007860 15:80118595-80118617 ACAGGGCTGTAGAAGAAAGAGGG + Intronic
1131055478 15:89372052-89372074 AGATGGGTGTGAAGGGAAGGTGG + Intergenic
1131369157 15:91865367-91865389 ACATGGGCTTGGAGGGGAGAGGG + Intronic
1131438511 15:92441358-92441380 AGAGGGGTGTGGAAGCAAGAAGG + Intronic
1131519605 15:93103669-93103691 TAAAGGGTGTGGAGGAAACAGGG + Intergenic
1132543285 16:521401-521423 ACATGGTGGTGGGGGAAGGACGG + Exonic
1133829023 16:9304815-9304837 ACATGAGAATAGAGGAAAGATGG - Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1134090420 16:11388600-11388622 ACACGGGGGTGGTGGATAGAAGG - Intronic
1134354424 16:13467753-13467775 ACATGGGAGTGGACGAAGGAGGG - Intergenic
1135492577 16:22922717-22922739 CCATGGGGGTGCAGGAAGGAAGG - Intergenic
1136371179 16:29837030-29837052 ACGTGCGTCTGGAGGAGAGAAGG - Intronic
1137029429 16:35507600-35507622 ACGTGGACGTGGAGGAATGAGGG + Intergenic
1138871004 16:60885915-60885937 ACCAGGGTTTGGAGGAAAGGAGG - Intergenic
1139299558 16:65933720-65933742 ACGGGGGAGTGGGGGAAAGAGGG + Intergenic
1139320996 16:66113849-66113871 AGATGTGGGTGGAGGAAATATGG - Intergenic
1139342563 16:66278024-66278046 GCCTGGGTGTGGAGAAGAGAGGG - Intergenic
1141424352 16:83935621-83935643 ACTGGGGTGTGAACGAAAGAGGG + Intronic
1141579893 16:84990181-84990203 ACATGGGTGTGGAACAAGAAAGG - Intronic
1142676791 17:1518410-1518432 AGGTGGGTGAGGAGGAAAGGGGG + Exonic
1143130999 17:4676811-4676833 CCCTGGATGTGGAGGAAAAAAGG + Exonic
1143362116 17:6380450-6380472 TCACGGGAGTGGAGCAAAGATGG + Intergenic
1143671369 17:8398136-8398158 ATAGGGGTGTGGGGGGAAGATGG - Intergenic
1145396117 17:22496420-22496442 CCAAGGGTGTGGGGGACAGAGGG + Intergenic
1147178246 17:38669987-38670009 ACATGGGACTGGAGGAAGGGAGG + Intergenic
1147367664 17:39970068-39970090 AGATGAATGGGGAGGAAAGAGGG + Intronic
1147367682 17:39970120-39970142 AGATGAATGGGGAGGAAAGAGGG + Intronic
1147540735 17:41356595-41356617 ACAGAGGTGTGCAGGAAAGAAGG - Intergenic
1147547595 17:41414665-41414687 ACTTGGATGGGCAGGAAAGATGG + Intergenic
1147570974 17:41570855-41570877 ACATGTGGGTGGAGGGAGGAAGG + Intronic
1147759058 17:42785766-42785788 AAATGGGGAGGGAGGAAAGAAGG - Intronic
1148560756 17:48604521-48604543 GAATGGGTGGGGAGGAAGGAAGG + Exonic
1148580231 17:48738503-48738525 AGATGGGGGTGGAGGATAAAGGG - Intergenic
1149026486 17:52033054-52033076 ACATGGATTTGGAGGAAGGTGGG + Intronic
1149620725 17:58043091-58043113 ACAGGGGTGTGGAGGAAGCGTGG + Intergenic
1150159627 17:62884929-62884951 AGATGAGTGAGGAGCAAAGAGGG - Intergenic
1150594668 17:66593550-66593572 ACTTGGGGGTGGAGGGAGGAGGG + Intronic
1150609933 17:66725913-66725935 ACATGGGTGGGGAGTAGAGATGG + Intronic
1150631233 17:66881822-66881844 AAATGGGCCTGGAGGAAAGTGGG + Intronic
1151139961 17:71981974-71981996 ACATGTGTGTGGAGGGTAGGTGG - Intergenic
1152031837 17:77847565-77847587 ACAGGGGAGTGGAGGCAAAAGGG - Intergenic
1152997845 18:424932-424954 TCATGGGTGTGGGGGAGAGGAGG + Intronic
1153314687 18:3710356-3710378 AGCTGGGTGTGGAGGAGAAAGGG - Intronic
1153364118 18:4234942-4234964 ACAAGGGAGGGGAGGAAGGAAGG - Intronic
1153404720 18:4724186-4724208 ACAGGGCTGTAGAGGAATGAAGG + Intergenic
1153995065 18:10433697-10433719 ACATGGATGAGGAGGAAAAGAGG - Intergenic
1154489876 18:14913115-14913137 ACATGGATGTGCAGGAAATCTGG - Intergenic
1154977375 18:21473043-21473065 ACTTGGGTCTGGAGGAAAATGGG + Exonic
1155672570 18:28389130-28389152 ACAACTGTTTGGAGGAAAGAAGG - Intergenic
1155936808 18:31763062-31763084 ACTTGGGTGCTGAGGACAGAAGG - Intergenic
1156316876 18:35977707-35977729 AAAAGGGTATGGAGGAAAAATGG - Intronic
1157109850 18:44810281-44810303 AGATGGGTGTTCAGGAAGGAGGG - Intronic
1157210630 18:45739246-45739268 ACATGAGTGGGGAGGAGAGTAGG - Exonic
1157480610 18:48051271-48051293 AGATGGGTGAGGAAGAATGAGGG + Intronic
1158023806 18:52872121-52872143 ACATGGGAGAGGACCAAAGAGGG + Intronic
1158054395 18:53261333-53261355 ACGAGGGTGTGGAGCCAAGATGG - Intronic
1160393314 18:78553766-78553788 ACATGGGTGGGAAAGCAAGATGG + Intergenic
1160403688 18:78629676-78629698 CCATGGGAGTGGAGGGGAGATGG + Intergenic
1161082164 19:2316710-2316732 ACATGGATATGAAGGGAAGAAGG - Intronic
1161387955 19:4007079-4007101 CCATGGGTGGGGAGGCAGGATGG + Intergenic
1162069445 19:8144967-8144989 AGATGGCTGTGGAGGAGAGAGGG + Exonic
1163178689 19:15583718-15583740 ACATGTGGGTGGAGTAGAGAGGG - Intergenic
1163430479 19:17264213-17264235 ATCTGGGTGTGGAGGGGAGAGGG + Intronic
1163563204 19:18033264-18033286 GCAGGAGTTTGGAGGAAAGATGG - Intergenic
1164230659 19:23284870-23284892 ATGTCAGTGTGGAGGAAAGAAGG + Intergenic
1164592027 19:29512503-29512525 ACAAGGATGAGGAGGAAGGAGGG + Intergenic
1164813221 19:31174759-31174781 ACATTGGTATGGAGGGGAGAGGG + Intergenic
1164864351 19:31591470-31591492 GCAAGGGTGTGGATGCAAGAAGG - Intergenic
1165163361 19:33831945-33831967 ACATGGGTGTTGGGGACAGAAGG - Intergenic
1166756895 19:45198059-45198081 ACAGGAGTGTGGGGGAAACAAGG + Intronic
925291524 2:2751461-2751483 AGAGGGGTCTGGAGGGAAGAGGG - Intergenic
925407845 2:3617679-3617701 ACATGGTTGTGGAGGAAAAGCGG + Intronic
925709589 2:6725960-6725982 ACATGGGGGAAGTGGAAAGAGGG + Intergenic
926031673 2:9596203-9596225 ATATGGGGGTGGGGGAAAGGAGG - Intronic
927219872 2:20696873-20696895 AGATGGGAGGGGAGGTAAGAAGG - Intronic
927291430 2:21408544-21408566 AGATGAGGGTGGAGGAAGGAGGG + Intergenic
927705480 2:25294076-25294098 AGCTGGGTGTGGAGGAAGGAAGG - Intronic
928659543 2:33487446-33487468 ATTTGGGTGTGCAGGAAAGGAGG + Intronic
929089594 2:38201728-38201750 AAATGGTTGTGGAGGAAGGGAGG + Intergenic
929303435 2:40332412-40332434 ACATGTGTGTGGGGGGAGGACGG + Intronic
929546546 2:42858532-42858554 ACTTGGGTGTGGAGGGAGCAGGG + Intergenic
929559321 2:42945893-42945915 ACATAGGTGTGGGGGCATGAGGG + Intergenic
932177756 2:69618547-69618569 ACATGAGGGTGGAGGAGTGATGG - Intronic
932750265 2:74367063-74367085 GCATGAGTGTGGAGGTAGGACGG - Exonic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935915130 2:107941384-107941406 ACATGAGGCTTGAGGAAAGAAGG - Intergenic
936017274 2:108969130-108969152 ACAAGGGTGATGAAGAAAGAAGG + Intronic
937488545 2:122341351-122341373 GCTTGGGGGTGGAGGAGAGAAGG + Intergenic
938392582 2:130916964-130916986 ACAAAGGTGTGGAGGCAAGTGGG - Exonic
938605625 2:132889904-132889926 TGAGTGGTGTGGAGGAAAGAAGG + Intronic
938743139 2:134251896-134251918 CCAGGGGTGGGGAGGAGAGAGGG - Intronic
939217771 2:139262017-139262039 TCTGGGGTGTGGAGGGAAGAAGG - Intergenic
940498765 2:154467741-154467763 AAATGGGCGTTGAGAAAAGATGG - Intergenic
940768132 2:157811566-157811588 AAATGGGAATGGAGGAAATAAGG - Intronic
941448975 2:165635879-165635901 AAATGGGTATGGAGCAAGGAAGG - Intronic
941609948 2:167648535-167648557 ACATTAGTGTGGGGCAAAGATGG - Intergenic
941781738 2:169452778-169452800 AAATGGGGGTGGAGCCAAGATGG + Intergenic
941961753 2:171260873-171260895 ACTTGGGGGTGGAGGAGTGAGGG + Intergenic
943068467 2:183113872-183113894 ACATTGGAGTGATGGAAAGAGGG + Intergenic
943587820 2:189761128-189761150 ACATAGAAGTGGAGAAAAGAAGG + Intronic
943912297 2:193584295-193584317 GCCTGGGTGTGGAGCAGAGATGG - Intergenic
944030404 2:195228432-195228454 ACATGGGGGAGGAGCCAAGATGG + Intergenic
945223091 2:207504501-207504523 AAATGGTTGGGGAGAAAAGAGGG + Intergenic
948504060 2:238415916-238415938 TCATGGGTGGGGAGGGTAGAGGG + Intergenic
948786808 2:240356975-240356997 ACAGGGCTGCTGAGGAAAGAGGG + Intergenic
949076911 2:242065622-242065644 ACAGGGGTGTGGAGGAGAGCCGG + Intergenic
1168935818 20:1664634-1664656 ACATGGCAGGGGAGGAAGGAAGG + Intergenic
1170731092 20:18975335-18975357 ACAAGTGTGTGTATGAAAGAAGG - Intergenic
1171257494 20:23701197-23701219 ACCTGGGTGTGGAGTACAGAGGG - Intergenic
1171264908 20:23763356-23763378 ACCTGGGTATGGAGTACAGAGGG - Intergenic
1171274554 20:23845047-23845069 ACCTGGGTATGGAGTACAGAAGG - Intergenic
1171395172 20:24828527-24828549 ACCTGGCTGTGGAGGCCAGAGGG - Intergenic
1171937288 20:31286832-31286854 AAGTGGAAGTGGAGGAAAGATGG - Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172905330 20:38364807-38364829 ACAGGGGTGAAAAGGAAAGAAGG - Intronic
1173115980 20:40243330-40243352 ATATGGAGGTGGAGGAATGAAGG - Intergenic
1173219263 20:41117833-41117855 ATATGGGTGGGGAGGAAGCAAGG + Intronic
1173319663 20:41976033-41976055 AGAGGGGTGAGGAAGAAAGAAGG + Intergenic
1173561082 20:44006210-44006232 AAATGGGTGGGCAGGAAAGATGG + Intronic
1173780009 20:45748022-45748044 CCCTAGATGTGGAGGAAAGAAGG + Intronic
1173959154 20:47057838-47057860 ACAGGTGTGTGGAGGCAGGACGG + Intronic
1176733126 21:10520175-10520197 ACATGGGTGGTGAGAATAGAAGG + Intergenic
1176892779 21:14338638-14338660 ACAGGGATGGGGAGGTAAGAAGG + Intergenic
1177045799 21:16168266-16168288 AAATGGATGTGGAGGAAGGGAGG - Intergenic
1178086615 21:29118727-29118749 AGATGAGTATGGAGGAAAGGAGG + Intronic
1178172758 21:30060302-30060324 AAATGGGTCTGGAGTAAACAAGG + Intergenic
1178232798 21:30806155-30806177 CGATGGGTGAGGAGGAAAGAAGG + Intergenic
1178915586 21:36704040-36704062 AGATGGGTGTGGGTGAAAGAGGG + Intronic
1179463286 21:41552265-41552287 ACTTGAGGGTGGAGGAAAGGAGG - Intergenic
1179832442 21:44005839-44005861 ACAGGGGTGTGGGGTAAGGAGGG - Intergenic
1180321858 22:11329264-11329286 ACATGTATGTGAAGGAAAGGGGG + Intergenic
1180469395 22:15641761-15641783 GCAAGGGGGAGGAGGAAAGAGGG - Intergenic
1180847674 22:18993126-18993148 ACTGGGGTGTGGTGGAAGGATGG + Intergenic
1181295759 22:21837312-21837334 GCAGGGCTCTGGAGGAAAGAAGG + Intronic
1181965398 22:26653021-26653043 ACATTGATGGGGAGGAGAGAAGG + Intergenic
1182289251 22:29266019-29266041 ACAGGGGAGGGGAGGAAGGAGGG - Intronic
1182414173 22:30210396-30210418 AAATGGGTGCGGAGGACAGCAGG + Intergenic
1182440812 22:30362783-30362805 ACATGGGGGTAGAGGAAAGAGGG + Intronic
1182642964 22:31783180-31783202 ACATGGGTGTGGACAAATAAGGG + Intronic
1183210789 22:36449960-36449982 AGGGGGTTGTGGAGGAAAGAAGG - Intergenic
1183735645 22:39643439-39643461 ATATGGGGGTGCAGGCAAGAGGG - Intronic
1183745433 22:39689047-39689069 ACAGGGTTGGGGAGGAAGGAAGG - Exonic
1183985503 22:41567973-41567995 AATTGGGTGTTGAGGGAAGAGGG - Intronic
1184919658 22:47596822-47596844 TCATGGGAGAGGAGGGAAGAGGG - Intergenic
949609241 3:5687243-5687265 AGCTGGGTGTGGAGGAATTAGGG + Intergenic
950591332 3:13937535-13937557 GCGTGGGTGTGGGGGACAGATGG + Intronic
950712400 3:14821652-14821674 GCGTGGGTGTGGGGGACAGATGG + Intronic
951188283 3:19739973-19739995 ACATGGGTGGGGTGGAGAGGGGG + Intergenic
951194035 3:19804154-19804176 GCTTGGGTGTGGAGGGTAGAGGG - Intergenic
951770066 3:26245195-26245217 ACATAGGGGTGGAGCCAAGATGG - Intergenic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
951862054 3:27263934-27263956 ACATGGGGGTGGAGCCAAGATGG - Intronic
952120083 3:30231934-30231956 ACATCTGTGGAGAGGAAAGATGG - Intergenic
952900713 3:38109927-38109949 TCATGGGTGGGCAGGAAAGGTGG + Intronic
953130552 3:40133892-40133914 ACAAGGGGGTGGAGCCAAGATGG + Intronic
953682772 3:45052060-45052082 AGATGGGAGTGGGGGAGAGAAGG - Intergenic
953830110 3:46289709-46289731 AGATGGGTGTGGAGAGCAGAGGG + Intergenic
954153909 3:48674260-48674282 ACATGGGTGTGGGGTGAAGAGGG + Exonic
954313837 3:49790192-49790214 GCATGTGTGTGAAGGAGAGAGGG - Intergenic
954544317 3:51419859-51419881 ACATTGGTGAGGAGTAAAGAGGG + Exonic
955041118 3:55318750-55318772 AGATGGGTGTTGAGTCAAGAAGG + Intergenic
955076387 3:55617524-55617546 ACATGGGTGTTGAAGAGACAGGG - Intronic
955669697 3:61391099-61391121 ACTTGGGGGTGGAGCCAAGATGG + Intergenic
956693510 3:71899478-71899500 ACTTGGTTGTGGAGTAAGGAGGG - Intergenic
957036741 3:75300607-75300629 AGACAAGTGTGGAGGAAAGATGG - Intergenic
958061258 3:88484500-88484522 ATATGGGAGTGGAGGATGGATGG + Intergenic
959803472 3:110523960-110523982 ACATGGCTGGGGAGGCAAGAAGG - Intergenic
960432032 3:117581079-117581101 AAATGGGGGTGGGGGAAGGAGGG - Intergenic
960731353 3:120731230-120731252 GCATTGGTGTGCAGGAGAGAGGG - Intronic
961550735 3:127669357-127669379 ACATGGTTTTGTGGGAAAGACGG + Intronic
961565451 3:127760406-127760428 ACGTGGGTGCTGAGGAATGAAGG + Intronic
962911622 3:139856210-139856232 TCCTGGGTGTGGAGCAGAGAGGG + Intergenic
962931515 3:140041875-140041897 ACCTGTGTGAGGAGGGAAGAGGG + Intronic
963303090 3:143620627-143620649 ACAGGGGGGTGGAGCCAAGATGG + Intronic
966386170 3:179401038-179401060 AAGTGGGGGTGGAGGAAAAAAGG - Exonic
968041367 3:195591995-195592017 ATCTGGGTGTGGAGGAATTAAGG + Intergenic
969278541 4:6153379-6153401 ACAAGGCTGTGGAGAGAAGAAGG - Intronic
969309416 4:6344587-6344609 ACATGTGTGTGCAGGAAGGGTGG - Intronic
969367934 4:6710333-6710355 CCAGGGGTGGGGAGGACAGAAGG - Intergenic
969565135 4:7972815-7972837 ACATGGGTGTGTCTGAGAGATGG - Intronic
970017039 4:11523166-11523188 ACAGGTGAGTGGATGAAAGAGGG + Intergenic
970829573 4:20321172-20321194 ACATTGGTTTGGAGGAGAGCTGG - Intronic
970951273 4:21758511-21758533 ACATGGGTTTAGAGAAATGATGG - Intronic
971099546 4:23448585-23448607 ACTTCACTGTGGAGGAAAGAGGG - Intergenic
972383088 4:38537013-38537035 ACTTGGGTGTGGAGCACAGTGGG - Intergenic
972455891 4:39254785-39254807 ACCAGGGTCTGGGGGAAAGAGGG - Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
973030174 4:45327737-45327759 ACATGGGAGTGGAGAGAACATGG + Intergenic
973165209 4:47069045-47069067 AAATGGAAATGGAGGAAAGAAGG - Intronic
974562606 4:63541282-63541304 GCTTGGGTGTGGAGCAGAGAAGG - Intergenic
975753895 4:77552927-77552949 GCATGGGCGTGGAGCAGAGAAGG + Intronic
976136848 4:81947043-81947065 ACATGGATGTGGAGGAGCAACGG - Intronic
976145465 4:82038703-82038725 GCAGGGTTCTGGAGGAAAGAGGG + Intronic
976297211 4:83484708-83484730 ACAGGGGCGCCGAGGAAAGATGG + Intronic
976951597 4:90839034-90839056 ACATGGTTGCGGAGGAAAAGCGG + Intronic
977459675 4:97309517-97309539 AATTGGGTGTGGAGAATAGATGG - Intronic
979139462 4:117153501-117153523 GCCTGGGTGTTGAGTAAAGAGGG + Intergenic
979737408 4:124104562-124104584 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
980991971 4:139745858-139745880 TCCTGGGGATGGAGGAAAGATGG + Intronic
981417129 4:144506328-144506350 ATAAGGATGTGGATGAAAGAGGG - Intergenic
981732411 4:147913558-147913580 ACATGGGTGCAAAGGAAAAAAGG - Intronic
981733122 4:147920899-147920921 ACTTGGTTGTGAAGGAAACATGG + Intronic
982866908 4:160525000-160525022 ACCTGTGTTTGGGGGAAAGAGGG - Intergenic
983963754 4:173785904-173785926 ACTTGGGGGTGGAGCTAAGATGG + Intergenic
985230590 4:187811786-187811808 TCAGAGGTGTGGAAGAAAGAAGG - Intergenic
985660368 5:1154021-1154043 ACATGCGTGTGGAGATGAGATGG - Intergenic
985679143 5:1246857-1246879 AAAAGGATGGGGAGGAAAGAGGG - Intergenic
985691448 5:1314920-1314942 CCAGGGGTCTGGAGGAAGGATGG - Intergenic
985870725 5:2553961-2553983 GCAGGGGTGTGGGAGAAAGATGG - Intergenic
986897447 5:12387301-12387323 AAATGGGTTAGGAGGACAGAGGG - Intergenic
986958651 5:13187675-13187697 GCATGCCTCTGGAGGAAAGAAGG + Intergenic
987040365 5:14056399-14056421 ACAGAAGTGGGGAGGAAAGAAGG + Intergenic
987669772 5:20991183-20991205 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
989978165 5:50609454-50609476 ACATGAGTGTTCAGGAATGATGG + Intergenic
992231167 5:74665499-74665521 ACATGTGTGTGTAGGAAAGCAGG - Intronic
993009076 5:82459237-82459259 ACATGGGCATGGAGCAGAGAGGG - Intergenic
993353043 5:86873324-86873346 ATATGAGTTTGGAGGAAGGAGGG + Intergenic
993492645 5:88570563-88570585 AGATGGGTGTGGAGAGAAGCTGG + Intergenic
993589186 5:89773078-89773100 GCATGTGTGTGAAGGGAAGAAGG + Intergenic
993753875 5:91703264-91703286 ACATGGGAAGGGAGGAAGGAAGG - Intergenic
994824734 5:104698692-104698714 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
995423600 5:111993844-111993866 ATTTGGGAGTGGAGGAAGGAAGG - Intronic
995535508 5:113131732-113131754 ACATGGGTTTGGAAGGCAGAGGG - Intronic
995726736 5:115189213-115189235 AAATGGCTGGAGAGGAAAGAGGG + Intergenic
996013136 5:118502894-118502916 AAATGGGGGTGGAGCCAAGATGG - Intergenic
996205863 5:120734271-120734293 ACAGGAGTGAGGAGGGAAGAGGG + Intergenic
997241641 5:132312271-132312293 ACATGGGAGGGGAGGAAGGTGGG + Intronic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
998383718 5:141743878-141743900 TCATGTGTGTGGTGGAGAGAGGG + Intergenic
999106230 5:149073600-149073622 AAATGGGTTTGGAGGAGATAAGG - Intergenic
999261568 5:150241818-150241840 GGAGGGGAGTGGAGGAAAGAGGG - Intronic
999466496 5:151811115-151811137 ACATAGGTGAGGAAGAAAGACGG - Exonic
999938303 5:156512776-156512798 ACATGGGTGTGGAAGTAGGAAGG - Intronic
1000185460 5:158853551-158853573 TCATAGGTGGGGAGGAGAGAAGG + Intronic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000360712 5:160444125-160444147 AGATGGGAGCTGAGGAAAGAGGG + Intergenic
1000673819 5:164095594-164095616 ACAGGGTAGTGGAGGAAAGCAGG + Intergenic
1002495426 5:179608241-179608263 ACATGGCTGTGGCAGAAAGGTGG - Intronic
1003011285 6:2429682-2429704 ACATGGGTGTGGGCCACAGACGG + Intergenic
1003741434 6:8945131-8945153 ACATGTTTGTGAAGTAAAGATGG + Intergenic
1004627785 6:17393473-17393495 AGAAGGGGGTGGAGGAAAGGAGG - Exonic
1005202761 6:23365101-23365123 ACATGTGGGTGGAGCCAAGATGG - Intergenic
1005711190 6:28504193-28504215 GCACGAGTGTGGAGCAAAGAAGG + Exonic
1006183519 6:32167731-32167753 AGAGGGGCTTGGAGGAAAGAGGG - Intronic
1006384689 6:33723841-33723863 ACAGGGGAGGGGAGGAGAGATGG - Intronic
1006499411 6:34448428-34448450 ACAAGGGTGGAGAGGAAAGATGG - Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009244135 6:61213978-61214000 AAATGGGTGAAGAGGAAAGAAGG + Intergenic
1009479978 6:64144663-64144685 ACATGGGGTTGGAGAAAGGATGG - Intronic
1009558581 6:65208309-65208331 ACAAGGATGTGGAGAGAAGAAGG + Intronic
1009782006 6:68283869-68283891 ACATTGGTGTGGAGCCAAGATGG + Intergenic
1010045012 6:71431735-71431757 ACATAGGAAGGGAGGAAAGAGGG - Intergenic
1010288451 6:74107615-74107637 AAATGGGTGTGTGGGAAAAAGGG + Intergenic
1010477310 6:76303882-76303904 ACTTGAGTGTGGAGGGAGGAGGG - Intergenic
1010989016 6:82458572-82458594 GCCTGGGGGTGGAGCAAAGAGGG + Intergenic
1011538303 6:88402339-88402361 ACATGGTTGAGGAGGAATGGAGG - Intergenic
1011911586 6:92447496-92447518 ACTTGAGGGTGGAGGATAGAAGG + Intergenic
1012142321 6:95639030-95639052 ACAAGGGTTTGAAGGAAAGAAGG - Intergenic
1012863082 6:104585030-104585052 AAATAGGTGTGGAAGGAAGAAGG - Intergenic
1013030500 6:106327834-106327856 AGATGGGTGAGGAAGAGAGAAGG - Intergenic
1013180057 6:107709603-107709625 ACATGAGTGGGAAGGAGAGAGGG - Intronic
1013350244 6:109299137-109299159 ACTTGGCTAGGGAGGAAAGAAGG + Intergenic
1015812699 6:137177322-137177344 ACATGGATGTGGAAGAAGGTTGG - Intergenic
1016040231 6:139425254-139425276 AGAAGGGGGGGGAGGAAAGATGG - Intergenic
1016233977 6:141839086-141839108 ACATGGGGCTGGAGGCAAGAGGG + Intergenic
1016768249 6:147819322-147819344 ACTTGGGGGTGGAGGATAGGAGG + Intergenic
1017019805 6:150130952-150130974 AAATGGCAGTGGTGGAAAGACGG + Intergenic
1017570817 6:155742365-155742387 AAAGGGGTGTTGAGGGAAGAGGG - Intergenic
1017624741 6:156337201-156337223 ACATGGGTTTGGAGAAAGGCAGG - Intergenic
1018126805 6:160690494-160690516 ACCTGGGTGTGGGGAAGAGAGGG - Intergenic
1018286184 6:162240353-162240375 GCATGCGTGGGAAGGAAAGAAGG - Intronic
1018398557 6:163400291-163400313 ACAGGGGGAAGGAGGAAAGAAGG - Intergenic
1018434537 6:163748869-163748891 ACATGCGAGTGGAGGAGAGGAGG + Intergenic
1018790395 6:167143769-167143791 ACGTGAGTGGGGAGGAAGGAGGG - Intergenic
1020538901 7:9436389-9436411 TCATGGGGGTGGAGCCAAGATGG + Intergenic
1020689621 7:11338390-11338412 AGAGGGGTGGGGAGGAGAGAGGG + Intergenic
1021016592 7:15543146-15543168 GAGTGGGTGTGGAGGAAGGAAGG - Intronic
1021339520 7:19446979-19447001 CCAAGGATGTGGAGGAAAAAAGG - Intergenic
1021424082 7:20479423-20479445 TCATGGGAGTGAAGAAAAGAGGG - Intergenic
1021434638 7:20600316-20600338 ACAGGAGGGTGGGGGAAAGATGG + Intergenic
1021476910 7:21072329-21072351 AAATGAGTGTAGAGGAAAGAGGG + Intergenic
1021989574 7:26128996-26129018 CCATGGGAGGGGAGGAAAGTGGG + Intergenic
1023359414 7:39400194-39400216 AGTTGGGTGTGGTTGAAAGAGGG + Intronic
1023863071 7:44227006-44227028 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023863314 7:44227709-44227731 AGGTGGGTGTGGGGGACAGAGGG + Intronic
1023899111 7:44461388-44461410 ACATGGGATGGGAGGATAGAAGG + Intronic
1024004553 7:45215970-45215992 ACATGGGCGGGGAGGGAAGAGGG + Intergenic
1024045486 7:45582759-45582781 ACATGGGGTAGGAGGACAGATGG - Intronic
1024121233 7:46243451-46243473 ACCTGGTGGTGGAGGAAAAAAGG + Intergenic
1024459965 7:49649735-49649757 ACAGGGGGGTGGAGCCAAGATGG + Intergenic
1025016268 7:55441224-55441246 ACATGGCTGGGGAGGAGGGAAGG + Intronic
1025807572 7:64849708-64849730 TCAGGGGTGTGGGGGAAAGGGGG + Intergenic
1026104177 7:67407932-67407954 ACAGGGGAGGGGAGGAGAGAGGG - Intergenic
1026304357 7:69127234-69127256 AAATGGCAGTGAAGGAAAGAGGG - Intergenic
1027912362 7:84267323-84267345 ACATGCATGTGTAAGAAAGATGG - Intronic
1027934848 7:84589275-84589297 GCCTGGGTGTGGAGTGAAGAGGG - Intergenic
1028169009 7:87573350-87573372 ACATCAGTGTGTAGGAAAGAGGG - Intronic
1028646853 7:93108257-93108279 ACATGCGTGTGAAGGGAGGACGG - Intronic
1030684961 7:112476544-112476566 ACTTGGGTGCTGAGGCAAGAGGG + Intronic
1030704009 7:112672316-112672338 CCATGGCTGGGGAGGAAAGGTGG + Intergenic
1031026793 7:116687943-116687965 AAATGGCTGTGGAGGAATGCAGG - Intronic
1032012462 7:128355877-128355899 CCATGGGTGAGAAGTAAAGATGG - Intronic
1032710394 7:134455923-134455945 ACATGGGTCTGGGGCAGAGATGG + Intronic
1035271521 7:157722684-157722706 ACAGGGGTGAGGAGGGAAGGAGG + Intronic
1035535454 8:387508-387530 ACAGGGGTGTGGAGGAGAGCCGG + Intergenic
1036536123 8:9654757-9654779 ACTTGGGGGTGGAGCCAAGATGG + Intronic
1037884551 8:22589354-22589376 ACCTGGGCCTGGAGGAACGAGGG - Exonic
1037956295 8:23063040-23063062 ACATGGATCTTAAGGAAAGAAGG - Intronic
1038537326 8:28362629-28362651 ACAAGGGTGAAAAGGAAAGAAGG - Intronic
1038655425 8:29446524-29446546 ACATGAGTGAGGAGAGAAGAGGG - Intergenic
1039245881 8:35607777-35607799 TCATGGCTGGGGAGGGAAGAAGG - Intronic
1039376299 8:37037564-37037586 ACATAGGTGGGGAGGAAGAAAGG - Intergenic
1039810730 8:41045845-41045867 ACATGGGTGGGGAGAAATAAGGG - Intergenic
1040670156 8:49680123-49680145 CCATGGGTCAGCAGGAAAGAGGG - Intergenic
1041311307 8:56519795-56519817 ACAGGGGTGTGTAGGAGAGGTGG - Intergenic
1041484465 8:58359207-58359229 ACGTGAGTGTGGTGGAATGATGG - Intergenic
1043385507 8:79744053-79744075 AGATGGGTGTGGGTCAAAGAAGG - Intergenic
1043597556 8:81902621-81902643 AGATGGGTTTGTAGAAAAGAAGG + Intergenic
1046073018 8:109281818-109281840 ACCTGGGTGTGAAGCAGAGAGGG - Intronic
1046854793 8:119018934-119018956 AAATGGGAATGGAAGAAAGAGGG - Intronic
1047930996 8:129728219-129728241 ACCTGAGTGTGGAGGAGAGAGGG - Intergenic
1047975806 8:130129094-130129116 AGAAGTGTGTGGAGCAAAGAGGG - Intronic
1048964163 8:139603301-139603323 GCAGGGGTGTGGCGGAGAGAGGG + Intronic
1050034923 9:1424851-1424873 ATCTGGGTGTGGAGCCAAGATGG - Intergenic
1050144977 9:2557391-2557413 ACGTGGGAATGGAGGAAAGAGGG + Intergenic
1050898560 9:10914508-10914530 ACAGGAGGGTGGAGGATAGAAGG - Intergenic
1051819021 9:21143024-21143046 ACATGGGTCAGGAGGAAAGGAGG - Intergenic
1051828075 9:21243690-21243712 ACCTGGGTCAGGAGGAGAGAAGG - Intergenic
1051876024 9:21794236-21794258 ACATGGGGCTGGAAGAAAGGAGG - Intergenic
1052163659 9:25294086-25294108 ACATGGATGCGCATGAAAGATGG + Intergenic
1053060072 9:35023731-35023753 AGATGGGTCTGTAGAAAAGAAGG + Intergenic
1053548842 9:39053821-39053843 ACATGTGTGTGGCAGGAAGAGGG - Intergenic
1053787921 9:41665443-41665465 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1053812960 9:41873889-41873911 ACATGTGTGTGGCAGGAAGAGGG - Intergenic
1053845363 9:42231209-42231231 ACATGAGGGTGGAGGATAGGAGG + Intergenic
1054157209 9:61649324-61649346 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054176197 9:61876785-61876807 GCTGGGCTGTGGAGGAAAGATGG - Intergenic
1054476984 9:65580329-65580351 AGCTGGCTGTGGAGGAAAGATGG + Intergenic
1054617635 9:67313550-67313572 ACATGTGTGTGGCAGGAAGAGGG + Intergenic
1054661342 9:67704023-67704045 GCTGGGCTGTGGAGGAAAGATGG + Intergenic
1055068837 9:72146401-72146423 ACAGAGGTTTGGAGGAAAGAGGG - Intronic
1055578987 9:77688372-77688394 ACAGGGGGGTGGAGCCAAGATGG - Intergenic
1056258666 9:84825726-84825748 ATATGGGGGTATAGGAAAGAAGG - Intronic
1056812325 9:89774461-89774483 ACATGGGTGGGTAGATAAGATGG + Intergenic
1057717371 9:97505271-97505293 CCATCTGTGAGGAGGAAAGAGGG + Intronic
1058640726 9:107081694-107081716 AACTAGATGTGGAGGAAAGAAGG - Intergenic
1058860969 9:109117454-109117476 ACCTGGGAGTGGGAGAAAGAAGG - Intronic
1059008939 9:110435467-110435489 AGATGGGGGTGGAGGGAAGCAGG + Intronic
1059034348 9:110737811-110737833 ATATGTTTGTGGAGGAAATAGGG + Intronic
1059043892 9:110843518-110843540 ACATGGTTTTGGGGGAAACAGGG + Intergenic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1060983729 9:127808217-127808239 ACCTTGCTGTGGAGGGAAGAAGG - Exonic
1061076108 9:128342213-128342235 ACATGGTTGCGGAGGAAAAGCGG - Intronic
1186977484 X:14923687-14923709 ACATGAGTGGGGAATAAAGAAGG - Intergenic
1187995766 X:24924794-24924816 GTAAGGGTGTGGAGGAAGGAAGG + Intronic
1189129307 X:38481696-38481718 GGATGGGGGTGGAGGAAGGATGG - Intronic
1189185760 X:39053320-39053342 ACATGGGAGCAGTGGAAAGATGG - Intergenic
1190429704 X:50367463-50367485 ACATGGGCCTGGAGAAATGAAGG - Exonic
1190462274 X:50689329-50689351 ACATGAGGGTGGAGGAATGATGG + Intronic
1192640868 X:72860496-72860518 ACATGGACGTGGATGAAAGTGGG - Intergenic
1193032715 X:76916703-76916725 ACATGGGGGTGGGGGGAGGAGGG + Intergenic
1193779211 X:85682658-85682680 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
1193787160 X:85773016-85773038 ACAGGGGGGTGGAGGCAAGATGG - Intergenic
1193920216 X:87415719-87415741 ACCTGGATGGGGAGGAAAGGAGG - Intergenic
1194896776 X:99451968-99451990 ACATGTTTGTGGAGGAAGAAGGG + Intergenic
1195734738 X:108000797-108000819 GCATGGGGGTGGAGCAGAGAGGG - Intergenic
1195740382 X:108059236-108059258 ACAGGGGTGGAGAAGAAAGAAGG + Intronic
1196036019 X:111146182-111146204 ACATGAATTTGGAGGCAAGAAGG - Intronic
1196124264 X:112082619-112082641 ACAGGGGTGGGGAGGATAAAGGG - Exonic
1196433378 X:115652012-115652034 ACAGGTGTGTGGGGAAAAGATGG - Intergenic
1196463127 X:115949511-115949533 ACAGGGGTTTGGAGGATAGGTGG + Intergenic
1196483912 X:116181918-116181940 ACTGGGGTGTGGAGGAGATATGG + Intergenic
1196678340 X:118444384-118444406 ACTTGGGTTTGGTGCAAAGATGG - Exonic
1196768436 X:119270700-119270722 ACACGGGTGTGGTGAAAATAGGG - Intergenic
1196930651 X:120678487-120678509 TCAGGGGAGTGGAGGAAATAGGG - Intergenic
1197230275 X:123996543-123996565 CTATGGTTGGGGAGGAAAGAAGG - Intronic
1197390824 X:125861522-125861544 GCCTGGGTGTGAAGCAAAGATGG - Intergenic
1198575493 X:138006035-138006057 ACATGGATGGGCAGGAAACATGG + Intergenic
1198736560 X:139792101-139792123 ACCTGGGGAAGGAGGAAAGAGGG + Intronic
1198891427 X:141401619-141401641 ACAGTCGTTTGGAGGAAAGAAGG + Intergenic
1199438644 X:147843230-147843252 ATATGGTTGTGGAGGAGAGCAGG + Intergenic
1199853986 X:151744852-151744874 ACATGCGTGTGCAGGGAAAAAGG - Exonic
1200184168 X:154170849-154170871 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200189821 X:154207977-154207999 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200195574 X:154245786-154245808 TCGTGGGTCAGGAGGAAAGAAGG - Intergenic
1200201227 X:154282907-154282929 TCGTGGGTCAGGAGGAAAGAAGG - Intronic
1201245922 Y:12003574-12003596 AAATGGGGGTGGAGCCAAGATGG - Intergenic
1201645365 Y:16223985-16224007 ATATGGGGGTGGAGCCAAGATGG - Intergenic
1201657448 Y:16361337-16361359 ATATGGGGGTGGAGCCAAGATGG + Intergenic
1201856116 Y:18545106-18545128 ACATGGGTGTGGAGGAAAGAGGG - Intergenic
1201877205 Y:18775279-18775301 ACATGGGTGTGGAGGAAAGAGGG + Intronic