ID: 1201884714

View in Genome Browser
Species Human (GRCh38)
Location Y:18868948-18868970
Sequence CATTTTAGGCACAGGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201884714_1201884718 -9 Left 1201884714 Y:18868948-18868970 CCATGCACCCTGTGCCTAAAATG No data
Right 1201884718 Y:18868962-18868984 CCTAAAATGTGCTTCTCCCATGG No data
1201884714_1201884721 13 Left 1201884714 Y:18868948-18868970 CCATGCACCCTGTGCCTAAAATG No data
Right 1201884721 Y:18868984-18869006 GTCTTGAAAACCTGCAGACCAGG No data
1201884714_1201884723 26 Left 1201884714 Y:18868948-18868970 CCATGCACCCTGTGCCTAAAATG No data
Right 1201884723 Y:18868997-18869019 GCAGACCAGGAGATTGCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201884714 Original CRISPR CATTTTAGGCACAGGGTGCA TGG (reversed) Intergenic
No off target data available for this crispr