ID: 1201893518

View in Genome Browser
Species Human (GRCh38)
Location Y:18969232-18969254
Sequence ACAGCCTAAAATTGTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201893516_1201893518 26 Left 1201893516 Y:18969183-18969205 CCATTGTACAACTGAAGAAATGA No data
Right 1201893518 Y:18969232-18969254 ACAGCCTAAAATTGTAAAGTTGG No data
1201893517_1201893518 0 Left 1201893517 Y:18969209-18969231 CCAGAAGATAATTCTTAGTTTAC No data
Right 1201893518 Y:18969232-18969254 ACAGCCTAAAATTGTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201893518 Original CRISPR ACAGCCTAAAATTGTAAAGT TGG Intergenic
No off target data available for this crispr