ID: 1201893944

View in Genome Browser
Species Human (GRCh38)
Location Y:18973583-18973605
Sequence AAATTAACATGAATGCCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201893944_1201893946 26 Left 1201893944 Y:18973583-18973605 CCAAAAGGCATTCATGTTAATTT No data
Right 1201893946 Y:18973632-18973654 CCTAAAGCTTATGAAATTTTAGG No data
1201893944_1201893947 29 Left 1201893944 Y:18973583-18973605 CCAAAAGGCATTCATGTTAATTT No data
Right 1201893947 Y:18973635-18973657 AAAGCTTATGAAATTTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201893944 Original CRISPR AAATTAACATGAATGCCTTT TGG (reversed) Intergenic