ID: 1201893944 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:18973583-18973605 |
| Sequence | AAATTAACATGAATGCCTTT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201893944_1201893946 | 26 | Left | 1201893944 | Y:18973583-18973605 | CCAAAAGGCATTCATGTTAATTT | No data | ||
| Right | 1201893946 | Y:18973632-18973654 | CCTAAAGCTTATGAAATTTTAGG | No data | ||||
| 1201893944_1201893947 | 29 | Left | 1201893944 | Y:18973583-18973605 | CCAAAAGGCATTCATGTTAATTT | No data | ||
| Right | 1201893947 | Y:18973635-18973657 | AAAGCTTATGAAATTTTAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201893944 | Original CRISPR | AAATTAACATGAATGCCTTT TGG (reversed) | Intergenic | ||