ID: 1201894456

View in Genome Browser
Species Human (GRCh38)
Location Y:18978734-18978756
Sequence GTTAAAAATACCAAGACAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201894456_1201894459 9 Left 1201894456 Y:18978734-18978756 CCAGCTGTCTTGGTATTTTTAAC No data
Right 1201894459 Y:18978766-18978788 AACCAAGTACATCCTTGGTATGG No data
1201894456_1201894458 4 Left 1201894456 Y:18978734-18978756 CCAGCTGTCTTGGTATTTTTAAC No data
Right 1201894458 Y:18978761-18978783 AAAACAACCAAGTACATCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201894456 Original CRISPR GTTAAAAATACCAAGACAGC TGG (reversed) Intergenic
No off target data available for this crispr