ID: 1201897177

View in Genome Browser
Species Human (GRCh38)
Location Y:19004376-19004398
Sequence CTGGGAAAGCAGAGTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201897171_1201897177 19 Left 1201897171 Y:19004334-19004356 CCACAGATTTATTCTGCAACATA No data
Right 1201897177 Y:19004376-19004398 CTGGGAAAGCAGAGTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201897177 Original CRISPR CTGGGAAAGCAGAGTGAGGA GGG Intergenic
No off target data available for this crispr