ID: 1201898321

View in Genome Browser
Species Human (GRCh38)
Location Y:19018082-19018104
Sequence ACATACATGAAAAAGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201898318_1201898321 -6 Left 1201898318 Y:19018065-19018087 CCCTGTCTCACACACACACATAC No data
Right 1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG No data
1201898315_1201898321 26 Left 1201898315 Y:19018033-19018055 CCTTGCATTCCAGCCTGAGTGAC No data
Right 1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG No data
1201898316_1201898321 17 Left 1201898316 Y:19018042-19018064 CCAGCCTGAGTGACAGAGTGAGA 0: 1829
1: 35217
2: 86785
3: 159723
4: 171977
Right 1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG No data
1201898317_1201898321 13 Left 1201898317 Y:19018046-19018068 CCTGAGTGACAGAGTGAGACCCT 0: 580
1: 8711
2: 30671
3: 74598
4: 133116
Right 1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG No data
1201898319_1201898321 -7 Left 1201898319 Y:19018066-19018088 CCTGTCTCACACACACACATACA No data
Right 1201898321 Y:19018082-19018104 ACATACATGAAAAAGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201898321 Original CRISPR ACATACATGAAAAAGGTGAA AGG Intergenic
No off target data available for this crispr