ID: 1201898913

View in Genome Browser
Species Human (GRCh38)
Location Y:19026053-19026075
Sequence AAGTGGGTGAATGGTATGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201898913_1201898920 18 Left 1201898913 Y:19026053-19026075 CCGTTCATACCATTCACCCACTT No data
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data
1201898913_1201898921 28 Left 1201898913 Y:19026053-19026075 CCGTTCATACCATTCACCCACTT No data
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201898913 Original CRISPR AAGTGGGTGAATGGTATGAA CGG (reversed) Intergenic
No off target data available for this crispr