ID: 1201898916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:19026062-19026084 |
Sequence | CCCATCCAAAAGTGGGTGAA TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201898916_1201898920 | 9 | Left | 1201898916 | Y:19026062-19026084 | CCATTCACCCACTTTTGGATGGG | No data | ||
Right | 1201898920 | Y:19026094-19026116 | TGTAAATTTGTTTAAGTTGTTGG | No data | ||||
1201898916_1201898921 | 19 | Left | 1201898916 | Y:19026062-19026084 | CCATTCACCCACTTTTGGATGGG | No data | ||
Right | 1201898921 | Y:19026104-19026126 | TTTAAGTTGTTGGTAGCTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201898916 | Original CRISPR | CCCATCCAAAAGTGGGTGAA TGG (reversed) | Intergenic | ||