ID: 1201898918

View in Genome Browser
Species Human (GRCh38)
Location Y:19026069-19026091
Sequence AAACAAACCCATCCAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 31686
Summary {0: 4, 1: 329, 2: 14643, 3: 9902, 4: 6808}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201898918_1201898920 2 Left 1201898918 Y:19026069-19026091 CCCACTTTTGGATGGGTTTGTTT 0: 4
1: 329
2: 14643
3: 9902
4: 6808
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data
1201898918_1201898921 12 Left 1201898918 Y:19026069-19026091 CCCACTTTTGGATGGGTTTGTTT 0: 4
1: 329
2: 14643
3: 9902
4: 6808
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201898918 Original CRISPR AAACAAACCCATCCAAAAGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr