ID: 1201898919

View in Genome Browser
Species Human (GRCh38)
Location Y:19026070-19026092
Sequence GAAACAAACCCATCCAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201898919_1201898921 11 Left 1201898919 Y:19026070-19026092 CCACTTTTGGATGGGTTTGTTTC No data
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data
1201898919_1201898920 1 Left 1201898919 Y:19026070-19026092 CCACTTTTGGATGGGTTTGTTTC No data
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201898919 Original CRISPR GAAACAAACCCATCCAAAAG TGG (reversed) Intergenic