ID: 1201898920

View in Genome Browser
Species Human (GRCh38)
Location Y:19026094-19026116
Sequence TGTAAATTTGTTTAAGTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201898919_1201898920 1 Left 1201898919 Y:19026070-19026092 CCACTTTTGGATGGGTTTGTTTC No data
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data
1201898913_1201898920 18 Left 1201898913 Y:19026053-19026075 CCGTTCATACCATTCACCCACTT No data
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data
1201898918_1201898920 2 Left 1201898918 Y:19026069-19026091 CCCACTTTTGGATGGGTTTGTTT 0: 4
1: 329
2: 14643
3: 9902
4: 6808
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data
1201898916_1201898920 9 Left 1201898916 Y:19026062-19026084 CCATTCACCCACTTTTGGATGGG No data
Right 1201898920 Y:19026094-19026116 TGTAAATTTGTTTAAGTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201898920 Original CRISPR TGTAAATTTGTTTAAGTTGT TGG Intergenic
No off target data available for this crispr