ID: 1201898921

View in Genome Browser
Species Human (GRCh38)
Location Y:19026104-19026126
Sequence TTTAAGTTGTTGGTAGCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201898913_1201898921 28 Left 1201898913 Y:19026053-19026075 CCGTTCATACCATTCACCCACTT No data
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data
1201898918_1201898921 12 Left 1201898918 Y:19026069-19026091 CCCACTTTTGGATGGGTTTGTTT No data
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data
1201898919_1201898921 11 Left 1201898919 Y:19026070-19026092 CCACTTTTGGATGGGTTTGTTTC No data
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data
1201898916_1201898921 19 Left 1201898916 Y:19026062-19026084 CCATTCACCCACTTTTGGATGGG No data
Right 1201898921 Y:19026104-19026126 TTTAAGTTGTTGGTAGCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201898921 Original CRISPR TTTAAGTTGTTGGTAGCTTC TGG Intergenic