ID: 1201904591

View in Genome Browser
Species Human (GRCh38)
Location Y:19076653-19076675
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201904591_1201904611 26 Left 1201904591 Y:19076653-19076675 CCCCTCGGCAGCCCCTCACAGCA No data
Right 1201904611 Y:19076702-19076724 CGCTCCCGGAAGCCCCCAGTCGG No data
1201904591_1201904602 3 Left 1201904591 Y:19076653-19076675 CCCCTCGGCAGCCCCTCACAGCA No data
Right 1201904602 Y:19076679-19076701 CCCGGGCTCCCAGAACCCCCAGG No data
1201904591_1201904606 12 Left 1201904591 Y:19076653-19076675 CCCCTCGGCAGCCCCTCACAGCA No data
Right 1201904606 Y:19076688-19076710 CCAGAACCCCCAGGCGCTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201904591 Original CRISPR TGCTGTGAGGGGCTGCCGAG GGG (reversed) Intergenic
No off target data available for this crispr