ID: 1201904596 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | Y:19076664-19076686 |
Sequence | AGCCCGGGGGCTGCTGTGAG GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1201904596_1201904606 | 1 | Left | 1201904596 | Y:19076664-19076686 | CCCCTCACAGCAGCCCCCGGGCT | No data | ||
Right | 1201904606 | Y:19076688-19076710 | CCAGAACCCCCAGGCGCTCCCGG | No data | ||||
1201904596_1201904602 | -8 | Left | 1201904596 | Y:19076664-19076686 | CCCCTCACAGCAGCCCCCGGGCT | No data | ||
Right | 1201904602 | Y:19076679-19076701 | CCCGGGCTCCCAGAACCCCCAGG | No data | ||||
1201904596_1201904611 | 15 | Left | 1201904596 | Y:19076664-19076686 | CCCCTCACAGCAGCCCCCGGGCT | No data | ||
Right | 1201904611 | Y:19076702-19076724 | CGCTCCCGGAAGCCCCCAGTCGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1201904596 | Original CRISPR | AGCCCGGGGGCTGCTGTGAG GGG (reversed) | Intergenic | ||